Prokaryotic Gene Regulation_Kieber 3.22-3.30

Prokaryotic Gene Regulation_Kieber 3.22-3.30 - Lecture 5:...

Info iconThis preview shows pages 1–18. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Lecture 5: Regulation of Gene Expression in Prokaryotes The Central Dogma transcription replication translation RNA Polymerase Ribosome DNA RNA Protein Cellular machinery is largely made up of proteins . Proteins are made up of chains or sequences of amino acids . The sequence of these amino acids are "encoded" in the cell's DNA. DNA is transcribed into RNA, which is then translated into protein. When one gene is mutated, one protein is affected (usually disabled). Note: Analysis of human genome suggests that in general, multiple proteins arise from each gene in humans as a result of alternative splicing (will discuss in later lecture). As a general rule, one gene encodes one protein RNA contains ribose, rather than deoxyribose (difference of a single oxygen). RNA uses uracil rather than thymidine as a base; Uracil still base pairs with adenine. RNA is generally single stranded, rather than double stranded and thus is capable of folding into complex three-dimensional shapes. Differences Between RNA and DNA Differences between RNA and DNA building blocks (DNA) (RNA) Like DNA, RNA has POLARITY (5 and 3) Unlike DNA, RNA is usually single-stranded and flexible P P 1 4 3 2 5 Phosphate linkage here Phosphate linkage here 1 4 3 2 5 5 and 3 refer to the carbon positions on the sugar ring of RNA or DNA This hydroxyl group is required for RNA polymerization uracil (U) C N O C C C N H H O 1 2 3 4 5 6 H H thymine (T) C N O C C C N H H 3 C O 1 2 3 4 5 6 H H RNA contains a different base Uracil RNAs can fold into unique structures tRNA secondary structure tRNAs are highly specialized RNAs that function during translation tRNA tertiary structure 16S Ribosomal RNA secondary structure RNA secondary structures can be very complex Messenger RNA (= mRNA ; translated into proteins). Structural RNAs not translated. includes ribosomal RNA ( rRNA , which is an integral component of ribosomes), transfer RNA ( tRNA s which are involved in translation), small nuclear RNAs ( snRNA s, involved in RNA splicing) and small cytoplasmic RNAs ( scRNA s involved in protein trafficking). Two kinds of RNA Catalyzed by RNA polymerase a complex, multisubunit enzyme that catalyzes the formation of the phosphodiester bonds that link together the nucleotides in an RNA chain Transcription (coding strand) RNA is always synthesized 5 to 3 Therefore, the template strand is read 3 to 5 DNA complexed with RNA polymerase 5 GATCTGACTGACATAGACATAGAT 3 coding (= non-template) strand 3 CTAGACTGACTGTATCTGTATCTA 5 template strand 5 GAUCUGACUGACAUAGACAUAGAU 3 mRNA Transcription Gene Structure Transcription start site (AAAA) 5 (CAP) AUG Translation start site TAA 5UTR 3UTR Transcription Translation stop site Note: 5 CAP, poly A tail and intron only present in eukaryotes UTR = untranslated region....
View Full Document

Page1 / 65

Prokaryotic Gene Regulation_Kieber 3.22-3.30 - Lecture 5:...

This preview shows document pages 1 - 18. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online