Hom01 - BSCI 410 Molecular Genetics Due Tuesday, Sept. 21,...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
1 of 2 BSCI 410 Molecular Genetics Homework 1 Due Tuesday, Sept. 21, 2010 (AT THE BEGINNING OF CLASS) Coverage: Lectures 1-6 This homework is worth a total of 20 points. Please type or write your answers clearly on a separate sheet of paper. If you use more than one sheet of paper, please use a stapler. 1 . (1 point) Here is the sequence of a single strand of DNA: 5' CAAGTTGTAACTCTAGGTTAGTCGCTACCTGTAGTCATTTA 3' Which of the following DNA strands would be synthesized by DNA polymerase, given the template strand above (assuming that an appropriate primer sequence is available)? a) 5' GTTCAACATTGAGATCCAATCAGCGATGGACATCAGTAAAT 3' b) 5' ATTTACTGATGTCCATCGCTGATTGGATCTCAATGTTGAAC 3' c) 5' CAAGTTGTAACTCTAGGTTAGTCGCTACCTGTAGTCATTTA 3' d) 5' TAAATGACTACAGGTAGCGACTAACCTAGAGTTACAACTTG 3' 2. (1 point) Which of the following is/are possible phenotypic outcome(s) after a single mitotic recombination event that occurs between the singed and yellow loci in a sn y+/ sn+ y somatic cell? (as opposed to occurring between the centromere and both genes). To answer correctly, you need to know the locations of the singed and yellow loci relative to the centromere (as shown in Hartwell figure 5.24 or lecture slides). a) normal cells b) a twin spot (a singed spot next to a yellow spot) c) a singed spot d) a yellow spot e) two yellow spots that are not next to each other 3 . (3 points) A red-eyed beetle was crossed to a beetle with pink eyes. The F1 progeny all had pink eye color. When F1 males and females were crossed to each other, 44 beetles with pink eyes and 16 beetles
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/07/2011 for the course BIO 325 taught by Professor Saxena during the Summer '08 term at University of Texas at Austin.

Page1 / 2

Hom01 - BSCI 410 Molecular Genetics Due Tuesday, Sept. 21,...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online