{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

14 Genetics

14 Genetics - GENETICS The Science of Heredity TFTD...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
GENETICS The Science of Heredity
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
TFTD: Genetics Genetics . Noun. Etymology: Greek, from γένεσις ( genesis ) meaning origin. 1 : The science of heredity and variation of organisms
Background image of page 2
Mendel Gregor Mendel observed that organisms inherit traits in a discrete manner He worked with pea plants and crossed them to observe variations in form and color
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Heredity What Mendel didn’t know: The basic units of inheritance are called genes Genes are sections of chromosomes, made up of DNA (or RNA – viruses)
Background image of page 4
DNA: Structure DNA: a sequence of nucleotides (base, sugar, phosphate) There are 4 types of nucleotide bases (A = adenine, T = thymine, C = cytosine and G = guanine) Bases pair up (A to T &
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Gene The sequence of nucleotides is the genetic information organisms inherit o So a gene is a specific sequence and length of base pairs (A,T, & C,G) A gene might look like: ATAACGTCCGATGGCCTCATAGG AA
Background image of page 6
Chromosomes The collection of genes (20-25,000 in humans) are housed in chromosomes Most animals are diploid (somatic cells have two sets of chromosomes)
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Chromosomes Structure and packaging
Background image of page 8
Heredity: Replication DNA occurs as a double strand in a helix type spiral ( Watson & Crick – 1962 Nobel prize ) Each strand is a template for creating a new partner strand o This is the physical method for making copies of genes that can be inherited
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
DNA Replication
Background image of page 10
DNA nucleotides in a gene are translated by cells to
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 40

14 Genetics - GENETICS The Science of Heredity TFTD...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online