MIT7_13f08_lab24_ArchiveExample

MIT7_13f08_lab24_ArchiveExample - MIT OpenCourseWare...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: MIT OpenCourseWare http://ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms . pT9 pT9 insert is a truncated form (1st 1142 nt) of xxxY from P. aeruginosa cloned into pPL17 using EcoR1(5) and BamH1 (3) Primers used to amplify insert from pTF2 (full xxxY clone) : 5 EcoRI xxxY 825: (5 TO 3) G GA ATT C C C GCC ACC ATG TCA ATG TCC (In bold is the EcoRI site, in italics is the RBS sequence, rest is coding sequence) 3 BamHI xxxY 1979: (5 TO 3) CGG GAT CCA TGG GCG TCT TAA AGT TG (Rev Comp of 3 BamHI xxxY 1979: CAACTTTAAGACGCCCA T GGATCC CG BamHI site is in bold, xxxY sequence is in italics and the additional T between xxxY sequence and BamHI site for maintaining correct reading frame for GFP fusion protein) Insert sequence cloned: atgtccatgtccgacaaccttttttctgacgatgaggtactttcaatttcctcaagcccagaacagcgatcttctccgttctacctcaatatatcgc ccatgtcccacggatcagacaattctcagattaatacagtcatcattaattcgaagaaattgccctcaaatcaagcagacataagtttaaaaaa...
View Full Document

Page1 / 3

MIT7_13f08_lab24_ArchiveExample - MIT OpenCourseWare...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online