MIT7_13f08_lab26_pPUP18_sequence

MIT7_13f08_lab26_pPUP18_sequence - MIT OpenCourseWare...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT OpenCourseWare http://ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms .
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
>gi|460933|gb|U07164.1|U07164 Cloning vector pUCP18, Escherichia-Pseudomonas shuttle vector with beta-lactamase (bla) and LacZ alpha peptide (lacZ alpha) genes, complete sequence TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCG GATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGC ATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA TCAGGCGGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAA TAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGAT AAATCTGGAGCCGGTGAGCGTGGATCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGT AGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGA TTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAA AGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTC AGACCCCAATTACACGCCACTGGCTGTGCTTGCTGGGGTGACGGTGGCAACGGTGGCGGCCTTGCTGGGCTATCGCG TTGGAAAGAAACGAGGGAAAGGGGACTGATAAACCGGTCTTAGCCCCTCCCCTTGGTGTCCAACCGCTCTGTAGGCC TCTCAGGCGCCGCTGGTGCCGCTGGTTGGACGCCAAGGGTGAATCCGCCTCGATACCCTGATTACTCGCTTCCTGCG
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/11/2011 for the course BIO 7.012 taught by Professor Lander during the Fall '10 term at MIT.

Page1 / 3

MIT7_13f08_lab26_pPUP18_sequence - MIT OpenCourseWare...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online