MIT7_13f08_lab27_pMQ64_sequence

MIT7_13f08_lab27_pMQ - MIT OpenCourseWare http/ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT OpenCourseWare http://ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms .
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
>gi|110227252|gb|DQ642034.1| Shuttle vector pMQ64, complete sequence TATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGA AGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAA TATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTG AAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTT AAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATAC AGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGG GCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCA GAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGA TTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCG GTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCT GACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGC AGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAA ACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTCACGTGGAGCTTATCGGCCAGCCTCGCAGAGCAGGAT TCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCT ATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGC GAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAC CGCCGGCTGACCCGGCGGGGACGAGGCAAGCTAAACAGATCTCTAGACCTAATAACTTCGTATAGCATACATTATAC GAAGTTATATTAAGGGTTGTCGAGCCGCTGGTGCCGCTGGTTGGACGCCAAGGGTGAATCCGCCTCGATACCCTGAT TACTCGCTTCCTGCGCCCTCTCAGGCGGCGATAGGGGACTGGTAAAACGGGGATTGCCCAGACGCCTCCCCCGCCCC TTCAGGGGCACAAATGCGGCCCCAACGGGGCCACGTAGTGGTGCGTTTTTTGCGTTTCCACCCTTTTCTTCCTTTTC CCTTTTAAACCTTTTAGGACGTCTACAGGCCACGTAATCCGTGGCCTGTAGAGTTTAAAAAGGGACGGATTTGTTGC CATTAAGGGACGGATTTGTTGTTAAGAAGGGACGGATTTGTTGTTGTAAAGGGACGGATTTGTTGTATTGTGGGACG CAGATACAGTGTCCCCTTATACACAAGGAATGTCGAACGTGGCCTCACCCCCAATGGTTTACAAAAGCAATGCCCTG GTCGAGGCCGCGTATCGCCTCAGTGTTCAGGAACAGCGGATCGTTCTGGCCTGTATTAGCCAGGTGAAGAGGAGCGA GCCTGTCACCGATGAAGTGATGTATTCAGTGACGGCGGAGGACATAGCGACGATGGCGGGTGTCCCTATCGAATCTT CCTACAACCAGCTCAAAGAAGCGGCCCTGCGCCTGAAACGGCGGGAAGTCCGGTTAACCCAAGAGCCCAATGGCAAG GGGAAAAGACCGAGTGTGATGATTACCGGCTGGGTGCAAACAATCATCTACCGGGAGGGTGAGGGCCGTGTAGAACT CAGGTTCACCAAAGACATGCTGCCGTACCTGACGGAACTCACCAAACAGTTCACCAAATACGCCTTGGCTGACGTGG CCAAGATGGACAGCACCCACGCGATCAGGCTTTACGAGCTGCTCATGCAATGGGACAGCATCGGCCAGCGCGAAATA GAAATTGACCAGCTGCGAAAGTGGTTTCAACTGGAAGGCCGGTATCCCTCGATCAAGGACTTCAAGTTGCGAGTGCT TGATCCAGCCGTGACGCAGATCAACGAGCACAGCCCGCTACAGGTGGAGTGGGCGCAGCGAAAGACCGGGCGCAAGG TCACACATCTGTTGTTCAGTTTTGGACCGAAGAAGCCCGCCAAGGCGGTGGGTAAGGCCCCAGCGAAGCGCAAGGCC GGGAAGATTTCAGATGCTGAGATCGCGAAACAGGCTCGCCCTGGTGAGACATGGGAAGCGGCCCGCGCTCGACTAAC CCAGATGCCGCTGGATCTGGCCTAGAGGCCGTGGCCACCACGGCCCGGCCTGCCTTTCAGGCTGCGCAACTGTTGGG AAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGG GTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGG
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/11/2011 for the course BIO 7.012 taught by Professor Lander during the Fall '10 term at MIT.

Page1 / 6

MIT7_13f08_lab27_pMQ - MIT OpenCourseWare http/ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online