ps3 - MIT Biology Department 7.012 Introductory Biology...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Name: _________________________________________________ TA:____________________ 7.013 Problem Set 3 FRIDAY October 8th, 2004 Problem set answers must be inserted into the box outside Problem sets will NOT be accepted late. Solutions will be posted on the web. Question 1 a) Below is a schematic of an inset electron micrograph showing simultaneous transcription and translation of a gene in E. coli. Select the names from the following list of structures depicted in the schematic and write them on the lines adjacent to their symbol. (Use each term only once; you do not need to use all of them.) Some of the terms are explained in the book, i.e. page 265. 1. N-terminal of polypeptide 5. 5’ end of mRNA 9. messenger RNA 13. DNA 2. C-terminal of polypeptide 6. ribosome 10. GTP cap 14. 5’ end of DNA 3. 3’ end of mRNA 7. polypeptide 11. 3’ end of gene 15. DNA polymerase 4. Shine-Delgarno sequence 8. RNA polymerase 12. promoter 16. stop codon ___________ ___________ __________ ____________ ___________ A ____________ B _____________ C ___________ D _____________ E _____________ F ____________ G ____________ b) According to the schematic, in which direction are the structures symbolized by the checkered ovals moving? up down not moving left right c) In which direction are the structures symbolized by the striped boxes moving? up down not moving left right MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Image removed due to copyright reasons.
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
2 Question 2 Assume mRNA is being transcribed starting from the far left side of the following double stranded DNA template. 5’GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGACCCTATGATCATCCCGA5’ a) What are the first five nucleotides of the mRNA sequence? _________________ b) What are the first 5 amino acids encoded? ______________________________ c) The following sequences show (in bold) different mutations affecting the above DNA sequence. Assume none affect the expression of the mRNA synthesis. A. 5’GTGCT G AGCGGGAATGAGCTGGGATACTAGTAGGGCT3’ 3’CACGA C TCGCCCTTACTCGACCCTATGATCATCCCGA5’ B. 5’GTGCTAGCGGGAATGAGCTG C GGATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGAC G CCTATGATCATCCCGA5’ C. 5’GTGCTAGCGGGAATGAGCTG A GATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGAC T CTATGATCATCCCGA5’ D. 5’GTGCTAGCGGGAATGAGCTGGGA A ACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGACCCT T TGATCATCCCGA5’ E. 5’GTGCTAGCGGGAATGAGCTGGGA C ACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGACCCT G TGATCATCCCGA5’ F. 5’GTGCTAGCGGGAATGAGCTGG C ATACTAGTAGGGCT3’
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern