ps3 - MIT Biology Department 7.012: Introductory Biology -...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Name: _________________________________________________ TA:____________________ 7.013 Problem Set 3 FRIDAY October 8th, 2004 Problem set answers must be inserted into the box outside Problem sets will NOT be accepted late. Solutions will be posted on the web. Question 1 a) Below is a schematic of an inset electron micrograph showing simultaneous transcription and translation of a gene in E. coli. Select the names from the following list of structures depicted in the schematic and write them on the lines adjacent to their symbol. (Use each term only once; you do not need to use all of them.) Some of the terms are explained in the book, i.e. page 265. 1. N-terminal of polypeptide 5. 5’ end of mRNA 9. messenger RNA 13. DNA 2. C-terminal of polypeptide 6. ribosome 10. GTP cap 14. 5’ end of DNA 3. 3’ end of mRNA 7. polypeptide 11. 3’ end of gene 15. DNA polymerase 4. Shine-Delgarno sequence 8. RNA polymerase 12. promoter 16. stop codon ___________ ___________ __________ ____________ ___________ A ____________ B _____________ C ___________ D _____________ E _____________ F ____________ G ____________ b) According to the schematic, in which direction are the structures symbolized by the checkered ovals moving? up down not moving left right c) In which direction are the structures symbolized by the striped boxes moving? up down not moving left right MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Image removed due to copyright reasons.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Question 2 Assume mRNA is being transcribed starting from the far left side of the following double stranded DNA template. 5’GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGACCCTATGATCATCCCGA5’ a) What are the first five nucleotides of the mRNA sequence? _________________ b) What are the first 5 amino acids encoded? ______________________________ c) The following sequences show (in bold) different mutations affecting the above DNA sequence. Assume none affect the expression of the mRNA synthesis. A. 5’GTGCT G AGCGGGAATGAGCTGGGATACTAGTAGGGCT3’ 3’CACGA C TCGCCCTTACTCGACCCTATGATCATCCCGA5’ B. 5’GTGCTAGCGGGAATGAGCTG C GGATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGAC G CCTATGATCATCCCGA5’ C. 5’GTGCTAGCGGGAATGAGCTG A GATACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGAC T CTATGATCATCCCGA5’ D. 5’GTGCTAGCGGGAATGAGCTGGGA A ACTAGTAGGGCT3’ 3’CACGATCGCCCTTACTCGACCCT T TGATCATCCCGA5’
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 6

ps3 - MIT Biology Department 7.012: Introductory Biology -...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online