ps4q_05

ps4q_05 - MIT Department of Biology 7.014 Introductory...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Name:______________________________________ Section :______ 7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions will be posted on the web. Question 1 Shown below is a fragment of the sequence of a hypothetical bacterial gene. This gene encodes production of CHWDWN, protein essential for metabolizing sugar yummose. The transcription begins (and includes) the G/C base pair in bold and proceeds to the right. 5’…TTCGA G CTCTCGTCGTCGAGATACGCGATGATATTAGTGGTAATATGGGGATGCACT…3’ ± 3’…AAGCT C GAGAGCAGCAGCTCTATGCGCTACTATAATCACCATTATACCCCTACGTGA…5’± a) Give the sequence of the mRNA transcribed from this gene and indicate the 5’ and 3’ ends of the mRNA. b) Give the sequence of the peptide that will be translated from this mRNA. Label the amino and carboxy termini of the peptide. c) You study two different mutants, Mutant A and Mutant B. i) In the DNA sequence for Mutant A, you find the insertion of a G/C base pair between positions 22 and 23 (position of insertion is indicated by an arrow): 5’…TTCGA G CTCTCGTCGTCGAGATACGCGATGATATTAGTGGTAATATGGGGATGCACT…3’ ± 3’…AAGCT C GAGAGCAGCAGCTCTATGCGCTACTATAATCACCATTATACCCCTACGTGA…5’± Give the sequence of the new peptide produced by mutant A. Label the amino and carboxy termini of the peptide. ii) In the DNA sequence for Mutant B, two consecutive G/C base pairs are inserted between positions 22 and 23 (position of insertion is indicated by an arrow on the figure above). Give the sequence of the new peptide produced by mutant B. Label the amino and carboxy termini of the peptide.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Question 1, continued d) One of these two mutants is fully functional, while the other is not. Which mutant peptide do you predict is functional and which one is not? Why? Question 2 You are fascinated by CHWDWN, and decide to continue your research over the summer. A graduate student in your lab has developed a collection of strains of bacteria containing different mutant tRNAs. a) In wild-type cells, what is the anticodon on the tRNA charged with trp? Indicate 5’ and 3’.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 7

ps4q_05 - MIT Department of Biology 7.014 Introductory...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online