ps4s_05

ps4s_05 - MIT Department of Biology 7.014 Introductory...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 7.014 Solution Set 4 Question 1 Shown below is a fragment of the sequence of a hypothetical bacterial gene. This gene encodes production of CHWDWN, protein essential for metabolizing sugar yummose. The transcription begins (and includes) the G/C base pair in bold and proceeds to the right. 5’…TTCGA G CTCTCGTCGTCGAGATACGCGATGATATTAGTGGTAATATGGGGATGCACT…3’ ± 3’…AAGCT C GAGAGCAGCAGCTCTATGCGCTACTATAATCACCATTATACCCCTACGTGA…5’± a) Give the sequence of the mRNA transcribed from this gene and indicate the 5’ and 3’ ends of the mRNA. 5’-GCUCUCGUCGUCGAGAUACGCGAUGAUAUUAGUGGUAAUAUGGGGAUGCACU…3’ b) Give the sequence of the peptide that will be translated from this mRNA. Label the amino and carboxy termini of the peptide. N-Met-Ile-Leu-Val-Val-Ile-Trp-Gly-Cys-Thr…-C c) You study two different mutants, Mutant A and Mutant B. i) In the DNA sequence for Mutant A, you find the insertion of a G/C base pair between positions 22 and 23 (position of insertion is indicated by an arrow): 5’…TTCGA G CTCTCGTCGTCGAGATACGCGATGATATTAGTGGTAATATGGGGATGCACT…3’ ± 3’…AAGCT C GAGAGCAGCAGCTCTATGCGCTACTATAATCACCATTATACCCCTACGTGA…5’± Give the sequence of the new peptide produced by mutant A. Label the amino and carboxy termini of the peptide. N-Met-Thr-Arg-C ii) In the DNA sequence for Mutant B, two consecutive G/C base pairs are inserted between positions 22 and 23 (position of insertion is indicated by an arrow on the figure above). Give the sequence of the new peptide produced by mutant B. Label the amino and carboxy termini of the peptide. N-Met-Asp-Ala-Met- Ile-Leu-Val-Val-Ile-Trp-Gly-Cys-Thr…-C 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Question 1, continued d) One of these two mutants is fully functional, while the other is not. Which mutant peptide do you predict is functional and which one is not? Why? Peptide A is truncated after three amino acids, so it is likely the one that is not functional. Peptide B has three extra amino acids on the amino terminus with respect to the wild-type peptide. These amino acids are not likely to affect the overall fold of the peptide. Thus, it is likely that peptide B is fully functional. Question 2 You are fascinated by CHWDWN, and decide to continue your research over the summer. A graduate student in your lab has developed a collection of strains of bacteria containing different mutant tRNAs. a) In wild-type cells, what is the anticodon on the tRNA charged with trp? Indicate 5’ and 3’. 5’-CCA-3’ or 3’-ACC-5’ b) In strain X, the 5’ nucleotide of the anticodon on the trp tRNA is changed to a G, and no wild- type trp tRNA is present. i. Would you expect CHWDWN polypeptide production in X to be affected? If yes, explain how it would be affected. If no, explain why not. The anticodon now reads 5’-GCA-3’. Because of the mutant anticodon, in strain X the tRNA charged
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 7

ps4s_05 - MIT Department of Biology 7.014 Introductory...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online