AnswerKeyP3v7F09 - 1 November 24, 2009 BIOLOGICAL SCIENCES...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
1 November 24, 2009 BIOLOGICAL SCIENCES 2810 Prelim #3 Please write your name on the line in the middle of this page. There are 12 numbered pages with writing in this examination booklet; please check to see that all pages are present. There are 2 extra pages at the end that you can tear out for your own use. This is a closed book examination. There are 6 problems, with a total value of 100 points plus 5 points of Extra Credit. The correct answers can be communicated with a very few pictures, numbers, or sentences: you are only punishing yourself by being long-winded. Only answers in the spaces provided will be graded. Exams should be handed in by 12:05 pm. _______________________________________________ Your Name _______________________________________________ Your TA’s Name ______________________________________________________________________ (Office Use Only) 1) (14 points + 2 points Extra Credit) __________ 2) (16 points) __________ 3) (10 points + 2 points Extra Credit) __________ 4) (17 points + 1 point Extra Credit) __________ 5) (18 points) __________ 6) (25 points) __________ Total (100 points + 5 points Extra Credit) __________
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Question #1 (14 points total + 2 points Extra Credit) A wild-type fragment of human genomic DNA is shown below. 5’ TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3’ 3’ AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCTTATAGGTACCCGTGG 5’ The red lines show the positions of breakpoints that can produce an inversion of the region between the red lines. (a) (6 points) Complete the box below by writing the next 10 nucleotides on each strand following those shown in a fragment of DNA containing the inversion. 5’ TCGATTCCGGAAAGCT TCGGCGCTTA (+6 points; +2 if strands reversed) 3’ 3’ AGCTAAGGCCTTTCGA AGCCGCGAAT 5’ (b) (6 points) You now want to diagnose the presence of the inversion by using PCR. One of the primers you will use for the PCR is: 5’ TCGATTCCGGAAAGCT In the box below, write the sequence of a 16 base primer that, in conjunction with the primer above, will produce the longest possible PCR product from DNA containing the inversion, but will not produce any PCR product from the wild-type DNA. Pay attention to the polarity indicated in the box. [ Note: the sequence in your answer should not cross either of the breakpoints.] TAGTTTCCCGGGACGT (+6 points) 5’ 3’ ATCAAAGGGCCCTGCA (+3 points if reversed above) + 2 points for GGTGCCCATGGATAT(X) (c) Extra Credit (2 points) The inversion above must be a paracentric, not a pericentric, inversion. What information would let you reach this conclusion? Hint: this is human, not yeast, DNA. The centromeres of human chromosomes are more than 1 million bp, so it would impossible for the two breakpoints of such a small inversion to be on either side of the centromere. +1 for saying just that there is no centromere.
Background image of page 2
3 Question #2 (16 points total) A 5 year old child has Down syndrome. The child and the parents are genotyped at
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/20/2011 for the course BIOGD 6057 at Cornell University (Engineering School).

Page1 / 16

AnswerKeyP3v7F09 - 1 November 24, 2009 BIOLOGICAL SCIENCES...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online