Bacterial Recombination

Bacterial Recombination - BACTERIAL RECOMBINATION Purposes...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
BACTERIAL RECOMBINATION Purposes A. Vaccine production (subunit type) B. Production of proteins (growth hormone) C. Amplification of DNA for identification (DNA fingerprint) End products A. Gene itself (to incorporate into other organisms, DNA fingerprinting) B. Protein (for Rx) Sources of DNA A. Gene libraries 1. collection of clones containing different DNA fragments (w/ genes). 2. Organism had its chromosomes cut with enzymes, 1. fragments placed in cloning vectors, 2. inserted into bacteria, and proteins identified B. cDNA - libraries 1. reversely transcribed from mRNA 2. Uses reverse transcriptase . 3. the desired gene (eucaryotic) may have a lot of DNA filler, introns , which mess up the engineering method. 4. This procedure does not have the introns since mRNA in eucaryotes is processed, leaving important stuff C. Synthetic DNA Terminology Restriction enzymes isolated in 1970 from bacteria function to protect bacterium from becoming infected by virus those bacteria w/o these restriction enzymes can be infected DNA probes To find genes of importance on DNA fragments (either those isolated or in libraries) Short segments of single-stranded DNA o made to order using sequence of complementary bases o unique to gene we are looking for o Radioactively labelled o stcks in region of desired gene eg. the unique sequence complimentary to the probe ATATGCGC in a gene
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Gives: ATCGATCGATCGTATACGCGATGCATGC ATATGCGC* Polymerase chain reaction (PCR ) To make many copies of a segment of DNA Starting material may be a little as one gene Separate the molecules of DNA into strands w/ heat Required: nucleotides, DNA polymerase (Taq), primers, dNTP's, temperature cycler After each cycle of synthesis, the strands are separated by heat to create single strands for more amplification 30 cycles or one day's work will increase target DNA by a billion times (2 30 ) procedure: A. fragment DNA piece w/ restriction enzymes B. denature
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 5

Bacterial Recombination - BACTERIAL RECOMBINATION Purposes...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online