Bacterial Recombination - BACTERIAL RECOMBINATION Purposes...

Info icon This preview shows pages 1–3. Sign up to view the full content.

BACTERIAL RECOMBINATION Purposes A. Vaccine production (subunit type) B. Production of proteins (growth hormone) C. Amplification of DNA for identification (DNA fingerprint) End products A. Gene itself (to incorporate into other organisms, DNA fingerprinting) B. Protein (for Rx) Sources of DNA A. Gene libraries 1. collection of clones containing different DNA fragments (w/ genes). 2. Organism had its chromosomes cut with enzymes, 1. fragments placed in cloning vectors, 2. inserted into bacteria, and proteins identified B. cDNA - libraries 1. reversely transcribed from mRNA 2. Uses reverse transcriptase . 3. the desired gene (eucaryotic) may have a lot of DNA filler, introns , which mess up the engineering method. 4. This procedure does not have the introns since mRNA in eucaryotes is processed, leaving important stuff C. Synthetic DNA Terminology Restriction enzymes isolated in 1970 from bacteria function to protect bacterium from becoming infected by virus those bacteria w/o these restriction enzymes can be infected DNA probes To find genes of importance on DNA fragments (either those isolated or in libraries) Short segments of single-stranded DNA o made to order using sequence of complementary bases o unique to gene we are looking for o Radioactively labelled o stcks in region of desired gene eg. the unique sequence complimentary to the probe ATATGCGC in a gene
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Gives: ATCGATCGATCGTATACGCGATGCATGC ATATGCGC* Polymerase chain reaction (PCR ) To make many copies of a segment of DNA Starting material may be a little as one gene Separate the molecules of DNA into strands w/ heat Required: nucleotides, DNA polymerase (Taq), primers, dNTP's, temperature cycler After each cycle of synthesis, the strands are separated by heat to create single strands for more amplification 30 cycles or one day's work will increase target DNA by a billion times (2 30 ) procedure: A. fragment DNA piece w/ restriction enzymes B. denature
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern