Adleman-ScAm94

Dna polymerase is an amazing little nanomachine a

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: lication of DNA by DNA polymerase is what life is all about. DNA polymerase is an amazing little nanomachine, a single molecule that Computing with DNA Copyright 1998 Scientific American, Inc. DNA MOLECULES—with their sequences of adenine, thymine, guanine and cytosine (represented by the letters A, T, G and C)—can be used to store information and to perform computations. The molecule shown here in color, GCAGTCGGACTGGGCTATGTCCGA, encodes the solution to the sample Hamiltonian Path Problem on the next page. “hops” onto a strand of DNA and slides along it, “reading” each base it passes and “writing” its complement onto a new, growing DNA strand. While lying there admiring this amazing enzyme, I was struck by its similarity to something described in 1936 by Alan M. Turing, the famous British mathematician. Turing—and, independently, Kurt Gödel, Alonzo Church and S. C. Kleene—had begun a rigorous study of the notion of “computability.” This purely theoretical work preceded the advent of actual computers by about a decade and led to some of the major mathematical results of the 20th century [see “Unsolved Problems in Arithm...
View Full Document

This note was uploaded on 11/28/2011 for the course COMP 790 taught by Professor Staff during the Fall '08 term at UNC.

Ask a homework question - tutors are online