
DNA-analysis - © J a m e s H o l m e s C e l l m a r k D i...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: © J a m e s H o l m e s / C e l l m a r k D i a g n o s t i c s / S P L DNA molecules are very long They may consist of millions of base pairs In order to study the structure of DNA, the molecules are broken up into smaller fragments by enzymes called restriction enzymes Restriction enzymes do not break up the DNA molecule randomly but ‘cut’ it at particular sites 2 Restriction enzymes For example, a restriction enzyme called EcoR1* ‘recognises’ the base sequence CAATTC and cuts it between the two A s--C-C-G-C-A-G-C-T-G-T- C-A-A-T-T-C- T-C-T-C-C-G-G-A-T-C-C-A recognised cut--C-C-G-C-A-G-C-T-G-T- C-A Other restriction enzymes cut the DNA in different places and so produce fragments which are easier to analyse--C-C-G- C-A-G-C-T-G-T- C-A--C-C-G- C-A-G C-T-G-T- C-A A-T-T-C-T-C-C- G G-A-T-C- C-C-A- A-T-T-C- T-C-T-C-C- G-G-A-T-C- C-C-A- A-T-T-C- T-C-T-C-C-G-G-A-T-C-C-A- Restriction fragments 3 The fragments can be separated using gel electrophoresis ( See slides 7 – 11) The fragments cut by the restriction enzymes are called restriction fragments 4 Genetic fingerprinting 90% or more of DNA does not carry nucleotide triplets that code for proteins The non-coding DNA is often called ‘junk DNA’ but this only means that its functions have not yet been discovered Some of the non-coding regions consist of repeated sequences of nucleotides For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- * The number of repeats in any one section of DNA varies from one individual to the next Since these sections do not code for proteins (and, therefore are not genes) there is no observable difference in these individuals Genetic fingerprinting 5 Particular repeat sequences can be ‘cut out’ by restriction enzymes For example-CATCCACGA CATGCATGCATGCATG CCACATCCA- restriction enzyme cuts here……………and…..….…..here or-CCACGA CATGCATGCATGCATGCATGCATG CCACAT- here…….…..…..………and…...….…………..here Restriction enzymes 6 Gel electrophoresis The different sized fragments are separated by a process called gel electrophoresis The separation takes place in a sheet of a firm but jelly-like substance (a ‘gel’) Samples of the DNA extracts are placed in shallow cavities (‘wells’) cut into one end of the gel A voltage is applied to opposite ends of the gel DNA has a negative charge and moves slowly towards the positive end The shorter fragments travel through the gel faster than the longer fragments Gel electrophoresis 7 gelatinous sheet well solution DNA extract added Gel electrophoresis 8 Voltage supply negative electrode DNA samples placed in wells cut in gel positive electrode thin slab of gel + DNA fragments Move from negative To positive Gel electrophoresis 9 A sample with the shorter DNA fragments travels through the gel faster than a sample with the larger fragments 10 Next slide 11 Appearance of separated fragments on gel...
View Full Document

{[ snackBarMessage ]}

Page1 / 39

DNA-analysis - © J a m e s H o l m e s C e l l m a r k D i...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online