Exam 2 (2005) - Biol 3301: Genetics Exam #2 November 1,...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol 3301: Genetics Exam #2 November 1, 2005 This exam consists of 50 questions worth a total of 100 points. All questions are multiple-choice. Each question has only ONE answer so choose the best answer. The Genetic Code Table is on the last page. Good luck! Please use the LAST FIVE DIGITS OF YOUR ID # Name_________________________ID#_____________________
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Question 1-9: Shown below (1-7) are locations of mutations in a gene which is responsible for cystic fibrosis. 5 7 4 6 Promoter 3 2 Gene mRNA Protein 1 The specific change at the DNA sequence level underlying each of the 7 mutations is underlined below. 1. T ATAAT Changed to T CTAAT 2. A TA Changed to A GA 3. G TG Changed to GG 4. CA A Changed to CA G 5. CGU Changed to TGU 6. AGA Changed to TGA 7. UAC Changed to UA GC 1. Which of the following is/are a transition mutation(s)? -b a. Mutation 7 b. Mutations 4 and 5 c. Mutation 3 d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 2. Which of the following is/are a transversion mutation(s)? -d a. Mutation 7
Background image of page 2
b. Mutations 4 and 5 c. Mutation 3 d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 3. Which of the following mutation(s) is/are likely to cause a splicing defect(s)? - c a. Mutation 7 b. Mutations 4 and 5 c. Mutation 3 d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 4. Which of the following is/are an example of a synonymous (silent) mutation(s)? - b a. Mutations 1 and 5 b. Mutation 4 c. Mutations 5 and 2 d. Mutation 7 e. Mutations 3 and 6 5. Which of the following mutations is/are likely to affect the size of the protein (# of amino acids)? - e a. Mutations 1 and 5 b. Mutation 4 c. Mutations 5 and 2 d. Mutations 3, 6 and 7 e. Mutations 3 and 6 6. Which of the following mutations is likely to affect the levels or rates of transcription? - a a. Mutation 1 b. Mutation 2 c. Mutation 4 d. Mutation 6 e. Mutation 7 7. Which of the following sequence(s) does mutation #2 change? - d a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence d. a and b e. All of the above 8. Which of the following sequence(s) does mutation #5 change? - a a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
d. a and b e. All of the above 9. Which of the following sequence(s) does mutation #6 change? - e a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence d. a and b e. All of the above Questions 10-13: The mRNA sequence of a gene is shown below Wild type: 5’ CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC 3’ Mutation 1: 5’ CCAGCAAUG CC UAAUCGCAGUUCGGAAUAGCAAGCC 3’ (Deletion of CC ) Mutant 1: 5’ CCAGCAAUGUAAUCGCAGUUCGGAAUAGCAAGCC 3’ Mutation 2: 5’ CCAGCAUAUGCCUAAUCGCAGUU C GGAAUAGCAAGCC 3’ (Base substitution of C to A ) Mutant 2: 5’ CCAGCAUAUGCCUAAUCGCAGUU A GGAAUAGCAAGCC 3’ 10. The amino acid sequence of the protein which is translated from the wild type mRNA is? -c a. N -Met-Pro-Asn-Arg-Arg-Ser-Glu- C b. C -Pro-Alal-Met-Pro-Asn-Arg-Ser-Ser-Glu-Tyr-Gln-Ala- N c. N -Met-Pro-Asn-Arg-Ser-Ser-Glu- C d. N -Pro-Ala-Met-Pro-Asn-Arg-Ser-Ser-Glu-Tyr-Gln-Ala-
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 12/02/2011 for the course BIOL 3301 taught by Professor Gunaratne during the Spring '05 term at University of Houston.

Page1 / 15

Exam 2 (2005) - Biol 3301: Genetics Exam #2 November 1,...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online