Exam 2 (2008 d) - Genetics Exam II 2008 1. Which of the...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetics Exam II 2008 1. Which of the following is NOT a difference between RNA and DNA? a. Sugar – ribose vs. deoxyribose b. 2’-OH c. 3’-OH d. Base - Uracil vs. Thymines e. None of the above. 23 25 26 24 3’ 5’ 27 Questions 2-7: Following is a diagram of replication in process. 2. What is the name of the element labeled #23? a. Leading strand b. Topoisomerase c. Okazaki fragment d. RNA primer e. Helicase 3. What is the name of the element labeled #24? a. Leading strand b. Topoisomerase c. Okazaki fragment d. RNA primer e. Helicase 4. What is the name of the element labeled #25? a. Leading strand b. Topoisomerase c. Okazaki fragment d. RNA primer
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
e. Helicase 5. What is the name of the protein labeled #26? a. DNA polymerase I b. RNA primase c. Topoisomerase d. DNA polymerase III e. Helicase 6. What is the name of the protein labeled #27? a. DNA polymerase I b. RNA primase c. Topoisomerase d. DNA polymerase III e. Helicase 7. Which of the following is NOT TRUE regarding the processing of the 3’ end of RNA transcripts? a. Is modified by the addition of 7-methyl guanosine cap. b. Is modified by the addition of a polyA tail. c. Has a polyadenylation signal; AAUAAA or AUUAAA, near the 3´ end of the transcript. d. Is modified by the splicing machinery. e. a and d Questions 8-11: The mRNA sequence of a gene is shown below. Answer questions 8-11 using this. Wild type: 5’ CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC 3’ 8. What is the sequence of the coding strand? a. 5’-CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC-3’
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 7

Exam 2 (2008 d) - Genetics Exam II 2008 1. Which of the...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online