Exam 3 (2010) - BIOL 3301 Midterm Exam #3 December 2, 2010...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
BIOL 3301 Midterm Exam #3 Morning blue December 2, 2010 There are a total of 11 pages in this exam. This exam consists of 34 questions worth a total of 100 points. All questions are multiple choice and there is one best answer for each question. Record your answers on the scantron sheet, and answer only once for each question or you will be automatically marked wrong. Use a #2 pencil. Name_________________________ ID#__________________________
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
1 : What process is problematic for translocated chromosomes? A) transcription B) mitosis C) meiosis D) replication 2: Which of these is NOT a method to determine where a protein-coding gene is expressed? a) RNA in situ hybdridization b) Detection with labeled antibodies c) Genome sequencing d) Use of a GFP-reporter construct 3 : Which of the following is most likely to produce abnormality such as sterility or even death in most cases? a) Euploidy b) Polyploidy c) Aneuploidy d) Diploidy e) All of the above 4: Why can the human genome not be assembled by shotgun sequencing alone? a) it is too big b) it contains many repetitive sequences c) it has many introns d) There are many chromosomes 5: Once the sequence of a genome is known which method would you use to learn about the genes it contains: a) Comparison with other genomes b) Looking for stretches that could code for proteins c) Search for transcription start and termination sites d) Make reporter constructs e) All of the above
Background image of page 2
6: Look at the gel below, which was generated by the dideoxy sequencing method. What is the DNA sequence of the original strand that was sequenced? ( Hint: Remember how the Sequencing reaction occurs: ) a) 5’ AAATCGCTTACGGGCTAGCTGGCAAATCTA 3’ b) 5’ TAGATTTGCCAGCTAGCCCGTAAGCGATTT 3’ c) 3’ AAATCGCTTACGGGCTAGCTGGCAAATCTA 5’ d) 3’ TAGATTTGCCAGCTAGCCCGTAAGCGATTT 5’ 7 : In order to obtain transgenic animals that make transgenic progeny a) The transgene needs to be integrated in the genome of germ cells b) The transgene needs to be somatically integrated c) The transgene needs to contain a centromeric region d) The transgene needs to be able to jump out of the genome 8 : Ti-plasmids a) Are used in Drosophila to make transgenic Drosophila b) Are the common method to make transgenic plants c) Are a part of Phage particles d) Contain the T-DNA region e) b) and d) 9. What makes polymerase chain reaction (PCR) possible? a) restriction enzymes b) ligase c) heat resistant DNA polymerase d) dideoxy nucleotides 10 : A tumor cell has started to make proteins that a normal cell does not make. If you perform a microarray experiment with cDNA of normal cells versus cDNA of tumor cells, what would you expect to find? a) can’t tell b) the patterns will look the same, so when one overlays the two reactions, all spots will be yellow c) additional spots with the tumor sample that correspond to genes that are newly expressed d) the two samples will give entirely different patterns
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
11. The restriction enzyme EcoR1 recognizes the following sequence of six nucleotide pairs in the
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 10

Exam 3 (2010) - BIOL 3301 Midterm Exam #3 December 2, 2010...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online