Exam 3 Review - 1: A wild-type chromosome can be...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1: A wild-type chromosome can be represented as ABC * DEFGH and from this a chromosomal aberration arises that can be represented ABC * DEGFH ( * = centromere). This is known as a: a) deletion. – would have deletion of a codon b) translocation. –there are no new codons (from another chromosome) so no. c) duplication. - no codons are repeated. d) pericentric inversion. – this would have A B or C on the other side of the centromere or vice versa e) paracentric inversion. – the inversion was not crossing over the centromere so this answer is correct 2 : Which of the following is most likely to produce abnormality such as sterility or even death in most cases? a. Euploidy – xN b. Polyploidy – Multiple xN c. Aneuploidy 2N+/-1 or 2n-2, many times causes abnormalities because the number of chromosome sets is not normal; only few are viable but still cause problems (like sterility) d. All of the above 3 : Which is NOT true: To make a knockout mouse a) Only mice with dark fur can be used - brown and black mice are used b) Mouse embryonic stem cells must be injected – yes, that’s how the whole experiment works c) Homologous recombination needs to take place - yes recombination must occur to create heterozygous mice in order to ensure the mutant gene is in all mice. d) A foster mother needs to be used – a surrogate mother is used to combine embryonic stem cells of the mutant mouse to non-mutant embryo e) Cells with successful integration of the manipulated gene need to be selected - yes, you must choose the mouse that has the mutant genes to be combined to form the knockout (curly tail) 4: Which is NOT true: Polymerase chain reaction (PCR) a) can use very little DNA as starting material – yes recall genetics lab b) uses primers - serve as a template for DNA synthesis by DNA polymerase when annealed to a longer DNA molecule. c) needs a heat-resistant DNA polymerase – the dna is denatured using heat so the polymerase must be able to withstandthese high temberatures d) requires the annealing of the primers with the template DNA - spontaneous alignment of two single DNA strands to form a double helix. 3 steps are denaturing,
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
e) produces only small amounts of product – No because there is actually an exponential increase 5: Why can the human genome not be assembled by shotgun sequencing alone? a. it is too big b) it contains many repetitive sequences c) it has many introns d) There are many chromosomes 6: Look at the gel below, which was generated by the dideoxy sequencing method. What is the DNA sequence of the original strand that was sequenced? ( Hint: Remember how the Sequencing reaction occurs: ) a. 5’ AAATCGCTTACGGGCTAGCTGGCAAATCTA 3’ b. 5’ TAGATTTGCCAGCTAGCCCGTAAGCGATTT 3’
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 12/02/2011 for the course BIOL 3301 taught by Professor Gunaratne during the Spring '05 term at University of Houston.

Page1 / 11

Exam 3 Review - 1: A wild-type chromosome can be...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online