Ch04_Motifs_mod

Ch04_Motifs_mod - www.bioalgorithms.info An Introduction to...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: www.bioalgorithms.info An Introduction to Bioinformatics Algorithms Finding Regulatory Motifs in DNA Sequences An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Outline Implanting Patterns in Random Text Gene Regulation Regulatory Motifs The Gold Bug Problem The Motif Finding Problem Brute Force Motif Finding The Median String Problem Search Trees Branch-and-Bound Motif Search Branch-and-Bound Median String Search Consensus and Pattern Branching: Greedy Motif Search PMS: Exhaustive Motif Search An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Random Sample atgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggcataaggtaca tgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtccacttatag gtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttctgggtactgatagca An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Implanting Motif AAAAAAAGGGGGGG atgaccgggatactgat AAAAAAAAGGGGGGG ggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaata AAAAAAAAGGGGGGG a tgagtatccctgggatgactt AAAAAAAAGGGGGGG tgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatg AAAAAAAAGGGGGGG tccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaat AAAAAAAAGGGGGGG cttatag gtcaatcatgttcttgtgaatggattt AAAAAAAAGGGGGGG gaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgt AAAAAAAAGGGGGGG caattatgagagagctaatctatcgcgtgcgtgttcat aacttgagtt AAAAAAAAGGGGGGG ctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcat AAAAAAAAGGGGGGG accgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagctt AAAAAAAAGGGGGGG a An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Where is the Implanted Motif? atgaccgggatactgataaaaaaaagggggggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataaaaaaaaaggggggga tgagtatccctgggatgacttaaaaaaaagggggggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaataaaaaaaagggggggcttatag gtcaatcatgttcttgtgaatggatttaaaaaaaaggggggggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa...
View Full Document

This note was uploaded on 12/03/2011 for the course BIO 118 taught by Professor Staff during the Fall '08 term at Rutgers.

Page1 / 102

Ch04_Motifs_mod - www.bioalgorithms.info An Introduction to...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online