bipedalism - Bipedalism and Early Human Ancestors Ancestors...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Bipedalism and Early Human Ancestors Ancestors The Search For the LCA (last common ancestor) between Humans and Chimpanzees Chimpanzees Genetic Methods: Molecular Clock Fossil finds from the late Miocene and Fossil early Pliocene early Molecular Clock There are always random changes There (mutations) in the DNA. (mutations) These mutation accumulate at a relatively These constant rate. If we know the rate at which mutations If occur, we can calculate the amount of time that has passed since two species shared a common ancestor. shared Mechanical Clock Mechanical We can obtain the We length of time by counting the number of ticks. of We can think about We mutations as the ticking of the molecular clock. molecular How does a molecular clock tick? How GATCGGTCACTCCTGCTAGTCGTGAA GATCGGTCGCTCCTGCTAGTCGTGAA GATCGGTCGCTCCTGCTAATCGTGAA GATTGGTCGCTCCTGCTAATCGTGAA Here we have 3 mutations from the original form. We know that mutations occur approximately every 4 We million years. million 3 x 4 = 12 The split from the ancestral form must have occurred The roughly 12 million years ago. roughly (We know that a mutation will occur approximately (We every 4 million years but we don’t know what that mutation will be) mutation Human-Chimpanzee Molecular Clock Clock Based on the amount Based of genetic differences between human and chimpanzee DNA it appears that we shared a common ancestor 6.85 Ma. ancestor The earliest hominid The fossils appear between 5-7 Ma. between Paleoanthropology Paleoanthropology Paleoanthropology is the study of early Paleoanthropology humans. Paleoanthropologists reconstruct the Paleoanthropologists anatomy, behavior, and ecology of our ancestors: ancestors: It is a diverse multidisciplinary pursuit It seeking to reconstruct every bit of information possible concerning the dating, anatomy, behavior, and ecology of our hominid ancestors. Multidisciplinary Multidisciplinary Refers to research involving mutual Refers contributions and cooperation of experts from various scientific fields (i.e., disciplines). various Hominid (Hominin) Hominid Members of the Members family hominidae including modern humans and their extinct bipedal ancestors. ancestors. Characteristics of Characteristics Hominids: Hominids: Bipedal Canine reduction Human Bipedalism Human Habitual: Bipedalism is Bipedalism our main form of locomotion locomotion Obligate: We are We anatomically comitted to bipedalism and can’t locomote efficiently in any other way. any Quadrupedal family from Turkey Human Bipedlaism Human “the body, step by step, the teeters on the edge of catastrophe” (Napier, 1967). 1967). The trick is to maintain a The stable center of gravity. Center of Gravity = the point at which the weight of an object is concentrated. concentrated. Center of gravity: the point at which the weight of an object is Center concentrated. concentrated. Center of gravity has to be over the legs Apes: Center of gravity is evenly Distributed over all four limbs Position of Foramen Magnum • Opening at the base of the skull through which the spinal cord emerges. • In Hominids it is positioned under the skull. • In quadrupeds it is positioned in the back of the skull. Curves in the spine Hominids: wedge-shaped vertebrae Pelvis Pelvis Hip bones (Os Coxae) Sacrum Pelvis Pelvis In bipeds the pelvis In has become short and broad. and Basin shaped to Basin stabilize the center of gravity over the legs and support internal organs. organs. Twists around the Twists spine like a steering wheel. wheel. Muscles that extend the hip Muscles Very large gluteus maximus keeps humans from falling forward while running or walking gluteus maximus small gluteus maximus large gluteus maximus ORANGUTAN Lesser gluteal muscles (LGM) Short, broad pelvis, LGM wrap around sides of hip joint LGM at back of pelvis, extend leg at hip Femur Femur Hominid femur is angled towards the midline - helps to maintain balance over one foot 900 CHIMP Lucy - Australopithecus Human Foot and Toes Foot The big toe is The enlarged and brought in line with the other toes toes distinctive longitudinal distinctive arch forms, helping absorb shock and adding propulsive spring. Explanations for Bipedality Explanations It’s efficent It’s cool It’s handy Human Bipedalism is Efficient Human More energetically efficient than knucklewalking It’s Cool It’s Bipedalism Bipedalism lessens heat stress in direct sunlight sunlight It’s Handy It’s Bipedality frees Bipedality up the hands for: for: feeding food transport tool use and tool transport transport Three major groups of early hominids: hominids: 1. Pre-australopiths-earliest and most -earliest primitive possible hominids (7.0-4.4 Ma.) Ma.) 2. Australopiths-diverse forms, some -diverse more primitive, others more derived. First definitive hominids. (4.2-1.2 Ma.) First 3. Early Homo-the first members of our -the genus (2.4-1.4 Ma.) genus Pre-australopiths Pre-australopiths Chad Chad Sahelanthropus tchadensis (2002) Sahelanthropus Kenya Kenya Orrorin tugenensis (2001) Orrorin Ethiopia Ardipithecus kadabba (2004) (2004) Ardipithecus ramidus (1994) Ardipithecus ALL EARLY HOMINIDS FOUND IN AFRICA Sahelanthropus tchadensis (6-7 Ma) (6-7 Oldest possible hominid Unusual combination of characteristics Very small brain (320380 cc) Huge browridges Large muscle attatchments Small vertical face Canine reduction worn at the tip Foramen magnum intermediate between human and ape. Orrorin tugenensis (5.8-5.2 Ma) (5.8-5.2 Femur indicates Femur possible bipedal locomotion locomotion Ardipithecus kadabba & Ardipithecus ramidus Ardipithecus (4.4-5.8 Ma; East Africa) (4.4-5.8 Ardipithecus kadabba (5.2-5.8 Ma.) (5.2-5.8 Canine Canine honing complex intermediate between apes and humans. humans. Toe bone Toe may indicate bipedalism. bipedalism. Canine Honing Complex Canine The upper canine The shears against the lower premolar to sharpen itself. sharpen Ardipithecus ramidis (Ardi) (Ardi) Ardipithecus ramidus (4.4 Ma) Ardipithecus Partial Skeleton Combination of ape-like and Combination human-like characteristics. human-like Blunt canines but still somewhat Blunt large. large. Molars small like a chimpanzee. Long arms in relation to the legs. Aspects of the pelvis appear to Aspects be bipedal. be Bipedal walking would have Bipedal differed from modern humans. differed Opposable big toe. Still doing a lot of climbing “Mosaic features” Questions Questions 1. What is a hominid? 2. What are the major characteristics that What distinguish hominids from other primates? distinguish 3. Around when did hominids first appear? 4. How can we tell when humans and How chimpanzees last shared a common ancestor? ancestor? 5. Name some of the changes that have taken Name place in the skeleton to accommodate bipedalism. bipedalism. Have a nice day! Have ...
View Full Document

This note was uploaded on 12/05/2011 for the course ANTHRO 102 taught by Professor F during the Spring '11 term at CUNY Queens.

Ask a homework question - tutors are online