bipedalism notes

bipedalism notes - Lecture notes 11/18/09 Bipedalism and...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Lecture notes 11/18/09 Bipedalism and the Earliest Hominids The Search for the LCA (last common ancestor) between Humans and Chimpanzees •Genetic Methods: Molecular Clock •Fossil finds from the late Miocene and early Pliocene Molecular Clock There are always random changes (mutations) in the DNA. These mutation accumulate at a relatively constant rate. If we know the rate at which mutations occur, we can calculate the amount of time that has passed since two species shared a common ancestor. Mechanical Clock We can obtain the length of time by counting the number of ticks. We can think about mutations as the ticking of the molecular clock. How does a molecular clock tick? GATCGGTCACTCCTGCTAGTCGTGAA GATCGGTC G CTCCTGCTAGTCGTGAA GATCGGTC G CTCCTGCTA A TCGTGAA GAT T GGTC G CTCCTGCTA A TCGTGAA Here we have 3 mutations from the original form. We know that mutations occur approximately every 4 million years. 3 x 4 = 12 The split from the ancestral form must have occurred roughly 12 million years ago. (We know that a mutation will occur approximately every 4 million years but we don’t know what that mutation will be) Human-Chimpanzee Molecular Clock Based on the amount of genetic differences between human and chimpanzee DNA it appears that we shared a common ancestor 6.85 Ma.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 12/05/2011 for the course ANTHRO 102 taught by Professor F during the Spring '11 term at CUNY Queens.

Page1 / 4

bipedalism notes - Lecture notes 11/18/09 Bipedalism and...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online