Sams midterm 2 reveiw

Sams midterm 2 reveiw - Week 7 Discussion Section Midterm...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Week 7 Discussion Section Midterm Review Worksheet- 2A and 1D 5’GATCGCATGTTAGGAATCTAACGT3’ +1 1. What is the 3’ complement to the above DNA strand? ____________________________________________ 2. PCR primer: 5’ACGTTACAT3’ a. Binds to which strand: Top OR Bottom b. Amplifies in which direction: ---> OR <--- c. This primer is a: Forward Primer OR Reverse Primer 3. Would 5’GATCGCATT3’ be a suitable forward primer? If not, why not? 4. What mRNA sequence would be made from the #1 site on the top strand? __________________________________________ 5. What protein would be made from the mRNA strand from question #4? __________________________________________ 6. If a tRNA had the anticodon CCU, it would read the mRNA sequence ______ and provide the Amino Acid _________________. 7. If a tRNA had anticodon on CCI instead, would this tRNA still be able to read the same part of the mRNA? 8. Question 7 is an example of _____________. 9. If this mRNA is a leader peptide for the Leu operon, its regulation would be: Strong OR Weak 10. Question 9 is an example of this type of regulation: 11. Circle where UV light can cause ____________ dimers in the above DNA.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 12/06/2011 for the course LS 3 taught by Professor Lin during the Spring '06 term at UCLA.

Page1 / 2

Sams midterm 2 reveiw - Week 7 Discussion Section Midterm...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online