04-ch10-DNA - We cannot cheat on DNA. We cannot get round...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: We cannot cheat on DNA. We cannot get round photosynthesis. We cannot say I am not going to give a damn about phytoplankton. All these tiny mechanisms provide the preconditions of our planetary life. To say we do not care is to say in the most literal sense that “we choose death.” Barbara Ward “Only One Earth” 1973 Chapter 10 Molecular Biology of the Gene Biology of the Gene What is the genetic material? What is its structure? is its structure? How is it copied? How is it expressed? Frederick Griffith 1920’s Streptococcus pneumoniae Streptococcus pneumoniae bacterium S strain (virulent) vs. R strain (non-virulent) Predict outcome for each of the following trials... outcome for each of the following trials inject a live mouse with: • live S mouse dies • heat-killed S mouse lives • live R mouse lives • heat-killed R mouse lives • live R + heat-killed S heat mouse dies(!!) Frederick Griffith discovery: transforming principle 1920’s By the early 1950’s, the existence of a biological molecule “blueprint” was known, but its identity was still unclear... Virus • DNA (or RNA) • wrapped in protein coat • reproduces using host Albert Hershey & Martha Chase proteins proteins • contain sulfur (DNA does not) • labeled with radioactive 35S DNA • rich in phosphorus (proteins are not) • labeled with radioactive 32P 1952 Albert Hershey & Martha Chase 1952 bacteriophage virus • during attack, part of the virus attack part of the virus enters bacterium, then takes over bacterial systems to produce next viral generation • part of the virus is left behind (outside) (outside) Which molecule is the key to viral replication? & perhaps also the reproduction of prokaryotic & eukaryotic cells... Hershey & Chase tested two prime suspects: DNA (which we now know to be in the viral core) Protein (which we now know to be the outer coat) Albert Hershey & Martha Chase proteins proteins • contain sulfur (while DNA does not) • labeled with radioactive 35S DNA • rich in phosphorus (while proteins are not) • labeled with radioactive 32P blender shakes loose the viral part left outside; shakes loose the viral part left outside; centrifuge separates this from bacterial contents • bacteria infected with 35S virus radioactive label found in supernatant liquid • bacteria infected with 32P virus radioactive label found within bacterial pellet radioactive label found within bacterial pellet DNA is key to viral replication; contains genetic code 1952 Albert Hershey & Martha Chase conclusion: DNA = genetic blueprint 1952 Watson Watson Crick Wilkins http://nobelprize.org/nobel_prizes/medicine/laureates/1962/index.html If DNA really is the genetic material... What is its structure? is its structure? http://www.pbs.org/wgbh/nova/photo51/ http://osulibrary.orst.edu/specialcollections/coll/pauling/dna/ Franklin DNA structure unraveled... • helix • double-stranded • antiparallel • complementary base pairs Each subunit of DNA (nucleotide) contains three parts... Complementary Base Pairs specific purines pair with specific pyrimidines A always pairs with T G always pairs with C always pairs with DNA strands are antiparallel (sugars are aligned in opposite directions) Unwind the double helix to replicate each strand... replication fork -- where the DNA strands are separated for replication DNA polymerases can add nucleotides in only one direction in only one direction DNA polymerases – enzymes that catalyze the formation of new DNA strand from a DNA template DNA ligase – unites fragments of the lagging strand; also mends breaks in DNA strands mends breaks in DNA strands Replication happens in many places simultaneously... replication bubbles expand toward bubbles expand toward each other between replication forks The product of semiconservative replication: each daughter DNA molecule contains parental strand + newly assembled strand What is the genetic material? What is its structure? is its structure? How is it copied? How is it expressed? Genetic information flows in one direction... transcription – assembly of RNA (polymer from RNA nucleotide monomers) along a template DNA strand translation – assembly of polypeptide chain (from of polypeptide chain (from amino acid monomers) using 3 types of RNA differences between RNA and DNA structure 1) single strand vs. double 2) different sugar in backbone in backbone 3) pyrimidine base Uracil replaces Thymine review formation of Hydrogen bonds between complementary base pairs Cytosine pairs pairs with Guanine Adenine pairs pairs with Thymine (or Uracil) there are 20 amino acids; these are the subunits from which all protein chains are made in protein synthesis, each amino acid specified by a codon (specific sequence of 3 nucleotides on mRNA) sequence of nucleotides on mRNA) each amino acid has several codons (redundancy) genetic code is nearly universal among organisms recall how RNA structure differs from DNA... phosphate group nitrogenous base Uracil vs. Thymine in DNA RNA molecule is a single strand ribose sugar for each gene, only one of the two DNA strands is transcribed a real gene can real gene can contain thousands of nucleotides... mRNA contains the triplet code methionine lysine phenylalanine stop production a real protein can contain (at least) hundreds of AA’s of AA’s from which the sequence of amino acids is determined three types of RNA play different roles in protein synthesis messenger RNA (mRNA) – template strand RNA containing the code for amino acid sequence transfer RNA (tRNA) – carries the incoming amino acids to the mRNA (which is in turn held in place between large small subunits of the ribosome) between large & small subunits of the ribosome) ribosomal RNA (rRNA) – along with proteins, makes up the ribosome (site of protein synthesis) th http://vcell.ndsu.edu/animations/transcription/movie.htm practice exercise, part I recall purine Adenine binds with pyrimidines Thymine or Uracil, and purine Guanine binds with pyrimidine Cytosine assemble the appropriate nucleotide sequence to replicate a daughter strand of DNA along this template DNA strand: ATGAATAAAGCGGTGGTTCGCTGA assemble the appropriate nucleotide sequence to transcribe a strand of mRNA along this DNA (daughter strand above): thi DNA (d TACTTATTTCGCCACCAAGCGACT ...
View Full Document

Ask a homework question - tutors are online