_OBRIEN-11__Gene Expression et cetera 91-98

_OBRIEN-11__Gene Expression et cetera 91-98 - GENE...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 8
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: GENE EXPRESSION is REGULATED at several levels: 1. Transcriptional Maj or regulatory control, over amount of primary RNA transcript 2. Post transcriptional processing A. Alternative splicing B. Polyadenylation, capping, transport C. Han life/turnover 3. Translational 1. M7G caps on mRNA (eukaryotes) 2. Shine - Dalgamo sequences (prokaryotes) 3. Secondary structure of mRNA 4. Abundance of specific tRNA (Minor species for low abundance proteins) 5. Derivatives of guanine nucleotides (“Magic spots”): ppGDP, ppGTP (prokaryotic systems) 6. Modification of initiation factors (i.e. eIF-Z phosphorylation in eukaryotes) 9/ Transcriptional regulation in Prokaryotic Systems Constitutive enmes - synthesized constant regardless of metabolic state Inducible enzymes - synthesized at variable rates, depending on “need” Coordinate induction of enzymes in particular metabolic pathways; “polycistronic mRN ” Classic example of transcriptional control: THE LAC OPERON 8mm genes .- / /\ 4/ ‘ DNA / / “pa? l \L j/ Wflfla’a‘f/Z‘ M / mRNA for/ repressor / polycistronic mRNA 1/ z / ,1 Proteins active repressor B-gal perrnease transacetylase +fm/aaer i (a inactive repressor Repressor control of Lac operon Promotor control (p') of repressor synthesis (i gene) (P) 9i THE LAC OPERON MAP OF LAC OPERON 26-14 Regulatory gene H‘———— Lactose operon h—q ~ 1' 7‘”; . - _ ; 1.7. .: r ‘7 in, ‘7 a: . . ~ Repressor — .7“ r Y a ‘ ‘ "f “ Permease Acetylase 1040 bp CRP site ~‘ifv‘f‘k‘fi-G'aléotos’ida'se " ”" v i promoter Promoter f: E. 00” chromosome 3072 hp 1251 bp 609 bp Operator (35 bp) CONFIGURATIONS OF LAC OPERON Fig. 26-15 RNA polymerase? (a) Transcription blocked Repressor mRNA 1 Repressor (b) Transcription activated Repressor mRNA 1 Messenger RNA Repressor U B-Galacrosidase lnducer i ‘ lnactivated repressor 93 The lac operator has symmetry . . . TGTGTGGAATTCTGAGCGGATAACAATTTCACACA ACACACCTTAACACTCGCCTATTGTTAAAGTGTGT 14—————————a 1 Protected by repressor . . . corresponding to the two-fold symmetry of the tetrameric lac repressor Symmetry is recuning motif in DNA-protein interactions Catabolite Repression - E. g)_l_i growing on glucose have low levels of B-gal and other catabolic enzyme - Glucose exerts this inhibitory effect by lowering the CAMP levels (cAMP is a “hunger signal”) - Exogenous CAMP relieves this “catabolite repression” - CAMP stimulates initiation of transcription of many inducible operons, including the lac operon 9‘} CONTROL OF LAC OPERON romoter o - erator i CRP o z y a Enuf'y site for RNA polymerase romoter o - erator RNA p01 Example of NEGATIVE control by repressor And POSITIVE Control by CRP 1. When [glucose] l, [cAMP]T 2. cAMP binds to CRP (“CAMP Receptor protein”) 3. CRP - CAMP binds to M in promoter of Lac operon 4. THEN RNA polymerase can bind to promoter entry site 5. If M is NOT occupied by repressor, transcription may proceed NOTE: Repressor binds to operator Repressor - inducer complex cannot bind to operator 9 5’ pry/2W. é/fl‘c/fliy fléfi W) [A 4 97/5/94 C A o g i gene 8 stop G C C G C T -80 Protected by cAMP/CRP 77? DWW) Mac A mutations TA TA Up flab/iii Up- *0 Protected by repressor "0C Ward/Mi! (CM fflécfiye) a “\\‘I I ' " ” 0"">-tnnm-«n)o>>-c + N O + (.0 O A )0 400Dn>>>00>0>ODO 4 - -<O>>‘>0000>O"D-‘">> ¢ + 40 1—2 gene start 0! m-«n «Sanctum—1440049.,qu 0300 5‘5, 26—17 % flZ/flflfffll” Another example of regulation: MW Some regulatory proteins control their own synthesis: “autogenous regulation” m ==J I II oeron C _ D A . mRMq t . @@ / repressor co-repressor Enzymes that make TRYPTOPHAN (tryptophan) trp Repressor binds directly to its own operator (the npR gene, encoding the trp repressor): “autogenous regulation" trp Repressor can also bind to the operator of the tip operon, but ONLY in the presence of u'yptophan, as a "co-repressor", regulating the transcription of mRNA encoding enzymes for tryptophan synthesis (with tryptophan, tipR CAN bind to tip operator) The tip operon has a second control mechanism :“W’ - Possible because translation and mscripticm are coupled - The rate of translation of the tip leader peptide (containing adjacent trp codons) depends on the abundance of (charged) trp-tRNA, which itself depends on the concentration of tryptophan. - Rapid translation of trp leader peptide (with abundant tryptophan) allows stable attenuator structure to form downstream, and RNA polymerase exits, and does not transcribe tip mRNA 97 TRP LEADER REGION, WITH ATTENUATOR SEQUENCE (Fig. 26.32) o < a o --—- o ---- -- o ----o o {a o .... -- 0----0 7 "’ D o ---- -- o ----O o ' 3 ---— < o "no 6‘ a o ---- (D ---- —— o----o 0 0 " < "" 3 o ----o ‘7 - o ---- o 7 a ---- ~- < 7 9 o < o 3 7 < o D o 3 wish attenuator > Region 0 I o 9 :> o 3 ca é o ““ 0 < 3 C7 ‘ 3 "" < "" "3 D 0 ' ---- 0 < :1; 0 V9 3[o "" 0 ‘9- 3 ° — —--- < < 3- o I D 3 o <—EndoltrpL >- D 0 ° i a [0 0 Z 2: > - 9 - Pb l - 2t ‘5 0 (5A 0 Met-Lys ("—l 9‘v_ >' 1' < O v~ 4o Mt-Gl -Thr 7 [\lr‘ ‘flAUUll-JFC 6’ Lari/\[V' 00 0 3; V9 74 l—ell—‘rLll—I / 4UGAAP~G GUACUG" 4Apt° $400 CAAUGCAAACA... 3, Begin rrpl. translation Begin rrpE rnRNAt ATTENUATION MECHANISM (Flg. 26.33) Adjacent RNA trp oodons polymerase Leader peptide RNA coding region 4 U-rich attenuator 5’ _ 3/ Ifiw (a) Stable conformation DNA u-p ribosome Adjacent trp codens allows 2-3 pairing :::::;»\:—K t \ Ribosome stalls / a” Low WPtOPhan levels FINA polymerase read-through TranslatiOn termination codon NO trp allows 3-4terminat0r forms A 1 \ 2 / 4 pairing 3-4 terminator l S cannot forrn ‘ RNA 3 polymerase Leader peptide coding region Adjacent DNA trp codons (c) High tryptophan levels 9:? ...
View Full Document

This note was uploaded on 12/09/2011 for the course BCH 4024 taught by Professor Allison during the Spring '08 term at University of Florida.

Page1 / 8

_OBRIEN-11__Gene Expression et cetera 91-98 - GENE...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online