_OBRIEN-15__Modification of bases in DNA et cetera 108-117

_OBRIEN-15__Modification of bases in DNA et cetera 108-117...

Info iconThis preview shows pages 1–10. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 10
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: W Example: The chemical mutagen Nitrous Acid (in some prepared foods) removes amino groups from A, G, and C to cause “transitions” C s G oxidative T:A Base pairs with CYTOSINE W Uracil Adam ADENINE /\ Hypoxanthine LXthine A:T G s C W lead to insertions and deletions ==§>Erame_shifi - ACRIDINE DYES, PROFLAVIN — ETHIDIUM BROMIDE - BENZOPYRENE r ALKXLAIINQAGENIS modify bases, changing coding properties - AFFLATOXINS in moldy grain or nuts alkylate guanines (missense) - DIMETHYL NITROSAMINES in prepared foods methylate bases W: 1. “Silent”; change in 3rd position of redundant codon 2. “MISSENSE”; affected codon specifies a different amino acid 3. “Nonsense”; codon changed into a stop codon; protein synthesis terminates prematurely W AFFECT LEVEL OF TRANSCRIPTION W: a) Alter pre existing splice site . b) Generate new or “cryptic” splice sites [08" Enzymes for DNA Analysis and Molecular Cloning Restriction endonucleases to fragment the DNA into defined segments DNA LIGASE to join DNA fragments DNA POLYMERASE to synthesize DNA on template to fill gaps REVERSE TRANSCRIPTASE ' to copy RNA into DNA -) “cDNA” RIBONUCLEASES (endo and exo) -) (- 5' 3' RNA POLYNIERASE TERMINAL TRANSFERASE For radiolabeling POLYNUCLEOTIDE KINASE For radiolabeling Alkaline Phosphatase To remove phosphate; 3' or 5' W - Cleave DNA in W manner - Evolved as a defense mechanism against infection by foreign DNA - different restriction enzymes in different organisms - protect DNA by Nomenclature /}w?\ Genus spec1es strain enzyme number Many restriction enzymes recognize “PALINDROMIC” sites J1 EcoRI 5' —GAATTC—3' cuts: 3' -CTI'AP}G—5' 5, _G,0H 3' —CTTAA 5' 5' ATTC—3' fip/G—S EcoRI will not cut at this site if the Adenine is methlated, as a means of protecting its own DNA from being digested: —- GAAmTTC ———» W111 not be cut by EcoRI x——~CITAmAG —— HO Digestion of DNA Digestion of a particular DNA gives specific, “invariant” fi'agments of characteristic size Example: 3.2 Kbp DNA 7004/ l, zoopé/a d, émé/ 5'— ATGAATTCCA GCCGAATTCTTT— 3' 3' —— TACTTAfiGGT GCCGTTAAZ‘GAAA ——"5' @EcoRI Restriction fragments of 2.0, 0.7, 0.5 Kbp cTAGH/l TTC TA 0“ ‘9? cmm‘mnsrr \b [i/l’CU/tzr fl/Vi «(:93 V < J _L 06,3 .339 Gflper Restriction fi'agments of 1.9 Kbp (linear!) ‘ 2.2 Kbp HI size - separation of DNA molecules and fragments by ELECTROPHORESIS WM 0/” // 'fi/fb/Ve Rate of DNA MIGRATION is inversely propOrtional to length - Size of DNA - Concentration of Agarose - Conformation of DNA - Applied voltage Linear A with insert Linear 3.2 Kbp A. )LHinDIlI RESTRICTION MAPPING Example: 6 Kbp linear DNA fragment - digested with various restriction enzymes EcoRI HinDIII PstI EcoRI Pqu 0.7 2.1 3.5 4.0 5.4 ’___|__L______l___|—_—L——+ o 6 KW Resulting Physical map [13 IDIZA B , LEI A DNA to DNA Hybridization (Southem blots) ‘ Genoiiic DNA DNA fragment (probe) or synthetic Restnftion digest(s) oligonucleotide Electrophoresis 32F or 358 :3 5:; “hot” probe 3' 5—; hybridize g: % washes m g to g ~35 Denature reduce , as? g blot background :5 a AGAROSE GEL Nitrocellulose Autoradiogram or (ethidium bromide) (+) Nylon Filter X—Ray Fihn DNA - PROTEIN INTERACTION “FOOTPRINTING” END - LABELED DNA \fl/p DNA binding protein DNA (/HlH'H/HUZHH/l.///(( I/H/Hx/f/I mm; +PROTE1N 1/5 W by W Method 1. Single stranded template 2. Synthetic oligonucleotide primer 3. DNA polymerase; elongation in presence of dideoxy NTP synthetic primer 5' 3' GAAACGGACTGTC AGCTTTGCCTGACAGAGTTCTAGATATC 3' 5' ~LElongate with dNTP in presence of ddATP GAAACGGACTGTCACAAGATCTA AGCTTTGCCTGACAGTGTTCTAGATATC Possible products: lL A A A A A M th ____________C ddCTP _——__C CA “NORTHERN” BLOTS (RNA blots) DNA to RNA Hybridization mRNA 1 Electrophoresis (agarose gel) 1 Blot (nitrocellulose or nylon) 1 DNA probe 32 P 35S ELISA Fluorescent Hybridization l D/sc/yfflfé [/7- ...
View Full Document

This note was uploaded on 12/09/2011 for the course BCH 4024 taught by Professor Allison during the Spring '08 term at University of Florida.

Page1 / 10

_OBRIEN-15__Modification of bases in DNA et cetera 108-117...

This preview shows document pages 1 - 10. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online