{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Summer final - UBC University of British Columbia...

Info iconThis preview shows pages 1–13. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 10
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 12
Background image of page 13
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: UBC University of British Columbia UBC """"'"'" Final Exam - August 16, 2008 w w Biochemistry 300 — Summer session W Time: 2.0 hours Total Marks: 150 Candidate’s Name: (Please print family name first.) Student Number: Candidate's Signature: This examination consists of 3 parts A. B. and 0. Part B has 22 questions and part c has 8 questions. The exam hes a total of 13 pages. Please check to ensure that this paper is complete. Answer all questions on this examination paper in the space provided. Read and observe the following rules: 1. Each candidate should be prepared to produce. upon request. hisrher librarylAMs card. 2. No candidate shall be permitmd to enter the examination after the expiration of ‘A hour. or to leave during the first ‘25 hour of the examination. 3. Candidates are not permitted to ask questions of the invigilators. except in cases of supposed errors or ambiguities in examination questions. CAUTION - Candidates guilty of any of the following. or similar. dishonest practices shall be immediately dismissed from the examination and shall be liable to disciplinary action: a) making use of any books. electronic storage devices. papers or memoranda. or cassette recorders other than those authorized by the examiners: b) speaking or oomrnunimting with other candidates: 0) purposely exposing written papers to the View of other candidates. d) The plea of accident or forgetfulness shall not be received. 4. Smoking is not permitted during examinations. 5. Cellular telephones must be fully turned fl. Mark Obtained: I150 Part A. Matching terms. Choose from the following list below and assign a number. Not all terms will be used. (30 marks) A. B. C. D. E. F. G. H. —_ J. K. 1. B-hydroxybutyrate 2. Lysine 9 mfleeew Giutamine synthetase DNA ligase Orotate ACC Oxaioacetate Glutaminase Minor groove 10. Uracil 11.Type I diabetes 12.Annealing 13. Pyruvate 14. RNA polymerase I 15. Thymine 16. DNA polymerase I 17. Hybridization 18.AAC 19.Type II diabetes 20. Pyridoxal phosphate 21 . Citrulline 22 23 24 25 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. . Glutamine synthase . L Dopa . CCA . RNA polymerase ll Adenylosuccinate Lactate Major groove Pribnow box AT rich tandem repeat Thiolase CoA transferase Acetoacetate Acetone Dna a HMG-CoA lyase GC rich palindrome Xanthylate Inosinate RNA polymerase III Pyridoxamine phosphate Ornithine An enzyme that joins two DNA fragments together. —_ The IMMEDIATE precursor to guanylate. The only three carbon ketone body. Eukaryotic RNA polymerase responsible for transcribing the tR NA genes. In this disorder. cells become less responsive to insulin. All tRNA molecules have this sequence at the 3' end. This enzyme cenverts aoetoacetyl CoA to two acetyl CoA. The o—keto acid of alanine. A sis—element required for prokaryotic replication. The enzyme that catalyzes the addition of an amino group onto glutamate. Specific term describing ssDNA from one species hydrogen bonding with complimentary ssDNA from another species, forming a double helix. (Identify the circled area) HN Part B. Multiple Choice. Circle the best answer. (44 marks) 1. Which of the following is the NOT a protease that acts in the small intestine? a. Chymctrypsin. b. Elastase. c. Enteropeptidase. d. Pepsin. e. Trypsin. 2. lsoleucine can be broken down into succinyl CoA and acetyl CoA. Therefore: a. When lsoteucine concentrations are low. it is used to make sugar. b. When Isoleucine concentrations are high. it can be used to make fatty acids. 0. Isoleucine is broken down more often during a very long fast. d. a and b. e. b and c. 3. All of the following contribute to the low error rate in DNA replication EXCEPT: a. DNA polymerase has functional groups that only stabilize a new purinefpyrimidine base pair. b. The polymerase lid only closes if the correct base pair is formed. c. DNA repair enzymes scan the DNA for mutations immediately after synthesis. d. DNA polymerase cleaves an incorrect nucleotide using its 5’->3' exonuclease activity. e. None of the above (i.e. all are true). The following hypothetical signal transduction pathway pertains to questions 4 and 5. i. A Hormone binds to a transmembrane receptor. activating it. ii. Activated receptor binds and activates Enzyme A. iii. Bound and activated Enzyme A catalyzes the conversion of X into Y. iv. Y binds to a Ca2+ channel, allowing large amounts of Ca2+ to enter the cell. v. Two Ca2+ bind a protein kinase. activating it. vi. The protein kinase phosphoryiates its target molecules. activating them. 4. in the above. which isiare the second messenger(s)? . The hormone. Molecule X. Ca2+. Molecule Y. c and d. b and 0. run: 9.9 pro: 5. in the above, which of steps amplify the signal? a. i and ii. b. iii. iv. and vi. c. iii, iv. v. and vi. d. ii, 1/. vi. 6. Which is NOT true about B-hydroxybutyrate? a. It is more oxidized than acetoacetate. b. It is produced in high levels in patients with uncontrolled type I diabetes. 0. It can be broken down to acetyl 00A in the heart. d. High leveis of it can lead to decreased blood pH. 7. Which of the following is NOT true about B-DNA? a. Two antiparailel poiynucieotide chains are coiled in a helix around a common axis. b. The DNA backbone associates with magnesium ions. c. The bases are nearly parallel to the axis. d. The pyrimidine and purine bases lie on the inside of the helix. 8. The B—ciamp allows DNA polymerase III: a. To replicate the DNA with high processivity. b. To remove mismatched base pairs. 0. To replicate the DNA with high fidelity. d. To unwind the double helix. 9. Formation of the bacterial 308 ribosomal initiation complex does NOT require? Tu. f-met tRNAfmgt. GTP. mRNA. 99 Fri” 10.Which of the following statements is true: a. Muscles cannot use fatty acids as an energy source. b. The brain cannot use ketone bodies as an energy source. c. Fatty acids are normally a preferable energy source over amino acids. d. In a well fed-human. about equal amounts of energy are stored as glycogen and as triacylglycerol. 11.Tyrosine can be converted into: a. Fumarate. b. Dopamine. c. Epinephrine. d. Serotonin. e. a. b, and c. f. All of the above. 12.Telomerase: a. Adds a repetitive DNA sequence to the chromosome. b. Contains an internal DNA template. c. Synthesizes DNA 3595'. d. Is active in E. ooii after DNA replication. e. a and d. 13.The compound that consists or ribose linked by a N-glycosidic bond to N-9 of adenine is: A deoxyribonucleoside. . A purine nucleotide. . A pyrimidine nucleotide. . Adenosine. . Adenosine monophosphate. manor!» 14.The DNA below is replicated from right to left. Which of the following is true? 5’—ACTTCGGATCGTTAAGGCCGTTTCTGT—3' 3'—TGAAGCCTAGCAATTCCGGCAAAGACA—5' The top strand is the leading strand. The bottom strand is the leading strand. The top strand is the lagging strand. The bottom strand is the lagging strand. a and d. b and c. deepen 15.The following statements about phenylalanine hydroxylase are true EXCEPT: a. it generates tyrosine. b. It is usually inactivated or deleted in phenylketonuria. c. it results in reduction of a single oxygen atom to water. d. Tetrahydrobiopterin is reduced to quinonoid dihydrobiopterin. 3. None of the above (i.e., all are true). 16. Which of the following statements about E. coir' RNA Pol. (core enzyme) is FALSE? a. It can start new chains de novo or elongate old ones. b. it has no catalytic activity unless the sigma factor is bound. 0. It uses nucleoside 5'-triphosphates as substrates. d. Its RNA product will hybridize with the DNA template. 17.Which of the following statements about glutamate dehydrogenase is true? a. Most cells express glutamate dehydrogenase. b. It only uses NAD” and generates NADH. c. It requires ATP. d. it catalyzes the addition of water across the Schiff base, releasing NHf. 18. Ingestion of the candy provided will result in the secretion of X in the blood, leading most cells to uptake glucose via Y. Where X and Y are: a. Insulin. GLUT4. b. Glucagon. GLUT1. c. Glucagen. GLUT4. d. Insulin. GLUT1. 19.Which of the following are features of the Wobble hypothesis? a. A naturally occurring tRNA exists in yeast that can read both arginine and lysine codons. b. A tRNA can only recognize one codon. c. Some tRNAs can recognize codons that specify different amino acids if both are non-polar. d. The “wobble“ occurs only in the first base of the anticod'on. e. The third base in a codon always forms a normal Watson-Crick base pair. 20. De novo purine synthesis differs from de novo pyrimidine synthesis in that only purine synthesis: 3. involves the attachment of the completed purine ring to ribose phosphate. b. Doesn't require carbamoyi phosphate. o. is inhibited by azaserine (azaserine inhibits enzymes that require glutamine). d. Requires aspartate. 21 .Which of the following is NOT phosphoryiated by protein kinase A: a. GIL. b. TAG lipase. c. Pyruvate dehydrogenase. d. Pyruvate kinase. 22. Which of the following is NOT true about the formation of the polyadenylate tail? a. Poly(A) polymerase binds to the poiyadenylation signal. b. it requires rATP. c. it requires an endonuclease. d. None of the above (i.e.. all are true). Part c: Short Answer Questions: 1. In 1978i James Morris and Quinton Rogers were studying feline nutritional requirements. In their study, three groups of cats were fasted for 15 hours and then fed a meal of protein with either: a) All twenty amino acids (group a). b) All twenty amino acids EXCEPT arginine (group b). c) All twenty amino acids EXCEPT arginine was replaced with omithine (group 0). The groups were then fasted again. Within two hours of feeding, cats in group b showed emesis (vomiting). neurological dysfunction. dyspnea (shortness of breath), and. in extreme cases. apnea (no breathing). Groups a and c showed no adverse affects. Blood samples at two hours after feeding revealed the following: ta. What is the purpose of group a? (2 marks) 1b. Why were the cats fasted before the protein meal? (4 marks) to. Using your knowledge from the course. explain what is happening in the group in cats two hours after feeding. What can you conclude about arginine in cats? (5 marks) 1d. Why did the cats in group 0 notshow the same symptoms as in group b? (4 marks) 2. What effect does glucagon have on glycolysis and gluconeogenesis in liver cells? How does it achieve this? Start with glucagon binding its receptor. (12 marks) 3. Regarding ribonucleotide reductase: 33. List the three nucleotide binding sites found in ribonucleotide reductase and the function of each. (6 marks) Nucleotide binding Site Function 1 . 2. 3. 3b. Suppose you have purified ribonucleotide reductase in a buffered solution containing high concentrations of ATP and dTTP and low concentrations of GDP. GDP, ADP and dATF’. How would you characterize the enzyme? Explain your answer! (4 marks) 4. Discuss the following mutations. including the effect each has on metabolism. 43. The 5’-)3’ exonuclease activity in DNA polymerase l is inactivated in E. coli. (3 marks) 4b. Loss of the intrinsic GTPase activity in Ga in muscle cells. (4 marks) 4c. The -10 upstream sequence of the gene encoding Your Favorite Protein has been converted from TATAAA to GAGAAT in human germ line cells. (4 marks) 5. Regarding Aspartate transaminase: 5a. Write out the most common reaction catalyzed by this enzyme. including structures and names. Make sure to include any cofactors (either stoichiornetric or catalytic). (4 marks) 10 5b. B-Methylene-DL-aspartate (BMA) is a very potent inhibitor of aspartate transaminase. What affect would BMA have on hepatocytes (liver cells)? You can assume the drug enters the cell. (5 marks) 6. The E. coli genome contains three separate copies of a gene that encodes a tRNA with the following anticodon: 5'-GUA-3’ 6a. Using the information on page 13. which amino acid would be attached to the tRNAs expressed by these three genes? (2 marks) 6b. Suppose you treat E. coli with a powerful mutagen. such that ONE of the tRNA genes now contains a mutation in the sequence encoding the anticodon. The anticodon now reads: 5’-CUA-3' Assuming the mutant tRNA can still bind the same amino acid in 6a, describe the behavior of this mutant tRNA. How could this affect translation? (5 marks) 11 60. Somewhat surprisingly. E. coli bacteria containing this mutation are able to survive and multiply. albeit at a slower rate. Provide a possible rationale for this. (4- marks) 7. What is this "structure? What is its function? (4 marks) 0 ““2 9H: m K E£W Hg’gij:>D die—fi4hfi—O N’ko TH“ i i i- . .c.., mg 8. Given the following prokaryotic DNA sequence: Sense Strand 3'—GATCTTGATATATGCCAT TTACCTCCTAAGTACAATGAGAAGAATCTAATTACATC-5' +1 5’wCTAGAACTATATACGGTAgtAATGGAGGATTCATGTTACTCTTCTTAGATTAATGTAG-3' +1 Antisense Strand Write out the sequence of RNA that would be transcribed. (4 marks) 12 Equations 8: Constants: F: 96.480 .w moi as“ = «FAB; R: 3.315 Jlmol K :36 = .szo + RT In 1919]- [AHBJ K = “C + 273 Where A & B are reactants and C & D are products pH = pKa + 109([A1IIHAD A Partial Genetic Code A c G U A AAC Asn AGA Arg AUC Ile AAG Lys AAU Asn C CAU His CCA Pro 066 Arg CUA Leu CCG Pro CUC Leu ' CCU Pro G GAG Glu GCG Ala GUA Val GAU Asp GUU Val U UAC Tyr UCA Ser UGU Cys UUA Lau UCU Ser UUC Phe UUG Leu UUU Phe 13 ...
View Full Document

{[ snackBarMessage ]}