HW5_2011 (1) - BME 339/ CHE 339/BIO 335 Fall 2011 Homework...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BME 339/ CHE 339/BIO 335 Fall 2011 Homework #5 Assigned: October 20, 2011 Due: Tuesday, November 1, 2011 Please type your answers and submit printouts No handwritten answers will be accepted 1. (Total 20 points, 5 points each) In mapping a large plasmid you notice that EcoRI yields three bands, HindIII yields four bands and you can detect at least 6 bands on the gel for the HindIII/EcoRI digestion. Give one sentence answer to the following questions. A) What is the inconsistency of these data? B) What are two possible explanations? C) How could you distinguish between these possibilities from scrutiny of the gel electrophoresis results? D) How would your answers to the above questions change if you had obtained the same data from digesting a bacteriophage lambda clone? 2. (20 points) Draw a restriction map for a circular DNA molecule using the following data: Restriction enzyme Fragment Size EcoRI 1200, 1100, 800, 400 HindIII 2500, 1000 BamHI 3500 EcoRI+HindIII 1200, 800, 700, 400, 300, 100 HindIII+BamHI 1800, 1000, 700 EcoRI+BamHI 1200, 1100, 500, 400, 300 3. (Total 20 points) A) (10 points) Suppose that 20‐base oligos are synthesized with the following sequence: 5' A C T A A G A N A C A Y T A G A C A G T 3' ,where the position identified as N can be A, C, T or G with 25% probability each, and the position identified as Y can be C or T with 50% probability each. What is the probability that a particular synthetic molecule would have the sequence: 5' A C T A A G A G A C A C T A G A C A G T 3' ? B) (total 10 points, 2 points each) Let’s say you aim to create a library of mutant genes based on the 1.5 kbp gene, GoodEnoughForNature (GEFN) to create SuperLabEvolvedGene (SLEG). You will use PCR mutagenesis to create a mutant gene library with a goal to achieve a 1% amino acid error rate. a) What PCR variables will you vary to obtain a library of mutant clones? b) How will you experimentally determine if you obtained the desired error rate? c) How many amino acids will be mutated, on average, if you achieved the 1% amino acid error rate? d) How large will you need to make your library to sufficiently cover the sequence space of this library one time? e) What step in the traditional cloning method outlined in class would potentially constrain your library size and why? 4. (20 points) Gene X is 1200 bp, and it is flanked on both sides by the sequence 5’‐GTTAAC‐3’, the recognition site for the enzyme Hpa I. Three unrelated people have been diagnosed as having a defective gene P. In all three people the defect is caused by a mutation that lies exactly 300 bp from the 5’ end of the gene. A sequencing gel was run from diseased and healthy individuals using the Sanger method and the resulting gels are shown below: Diseased Individual Healthy Individual What is the sequence of the relevant regions of the healthy and wild type genes (clearly label 5’ and 3’ ends) and what is the mutation? 5. (20 points) You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5’ CATACTTACTACTAGATTACGATTAGACGATTAGGATGGCCGACTCGTGCAGTAACAGCATGACCGAGG CCTAGACCAGATTAGGAGCCGGACCAGGACGGACCAGCGACT 3’ A) Assuming you are reading the non‐coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode (use the codon Table below) B) If you wanted to express this gene in E. coli, what would need to be presented in your cloning vector to ensure that it will be transcribed and translated? ...
View Full Document

Ask a homework question - tutors are online