PS8-11 - Bio D137 Human and Eukaryotic Genetics Prob Set 8...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Bio D137 Human and Eukaryotic Genetics J.L.Marsh F'11 Prob Set 8 due Tues, Nov 22 Name/student ID:_______________ 1 1 1] The genome project indicates the following restriction/transcription map for the region around the AMD, DDC and CAT genes (see fig below, genes AMD, DDC, CAT shown with direction of transcription indicated). A certain translocation is frequently found associated with Non-Hodgkin’s lymphoma. A patient who is a constitutive translocation heterozygote (i.e. he received the translocation from one of his parents) appears with Non-Hodgkin’s lymphoma. You wish to identify what gene is affected by the translocation. You use radiolabeled probes as indicated below to probe southern blots of Normal individuals (N/N) and this patient (N/T), and you get the following results. The bands represent the results of the Southern blots and the numbers refer to the sizes in kb of the various restriction fragments indicated by arrows. A] Can you identify the affected gene by analyzing these Southern blots (DNA blots)? Please do. B] Identify where the break most likely is and use well-labeled diagrams to explain what bands allowed you to make this conclusion, where the breakpoint could and could NOT be, and how any aberrant band sizes may have come about. 2] Finding genes in a DNA sequence can be challenging. In the simplest form, one looks for long open reading frames (ORFs). An ORF is a sequence of DNA without a stop codon – in other words, it’s a stretch of DNA that potentially encodes a protein. There are 6 possible “frames” for translating a DNA sequence – 3 forward, and 3 backward. In random DNA, you have less than a 1% chance of not finding a stop codon after ~280bp, due to the fact that 3 in 64 codons are stop codons. Thus, in practice some genes can be found by looking for long ORFs. Given what you know about the structure of genes and the start and stop translation sequences etc, please analyze this sequence. I am wondering if the following segment of recently sequenced genomic DNA contains a complete protein coding gene or not. Post this as a word doc TTAAAAAAACATATAAAGGCATGCCGCAATCGTGGATAATGTATCATAAGGCCGCGAGATCTCGTCGAGAATGCAGTTACTGTGCTACTTCGTCATC CTTTTCGTTGGAATCGCACCGTGGTCATCCTTGGCCAACGATGATGGATGCAACGAAGTGGTCTGCGGATCGGTGGTATCCAAGTGCCTCATCACCC AGAGCTGCCAGTGCAAGTTAAATGACTGCCACTGCTGCAAGGACTGTCTAAATTGCCTTGGCGAACTGTACATCGAGTGCTGTGGCTGCCTCGACAT GTGTCCCAAGCACAAGGATGTCCTGCCCTCGCTGACGCCGCGCTCGGAGATTGGAGACATTGAAGGAGTGCCCGAGCTGTTCGACACCCTAACCGCC GAGGATGACGAGGGATGGTCCACCATAAGGTTCTCCATGCGAGCCGGCTTCAAGCAGCGCGTTCAGGGCGGCGCGAGTGGTGATGCCGGAAACGGAA ATGGAAATGGAAATGCCGGGTCTGCAGGTGTCACCCTATGCACCGTGATCTATGTGAACTCGTGCATTCGGGCAAACAAGTGCCGACAGCAGTGCGA GAGCATGGGAGCCAGTAGCTATCGATGGTTCCACGACGGATGCTGCGAGTGCGTCGGCGAGAATTGCCTCAATTATGGAATCAACGAGAGTCGCTGC CGCGGTTGTCCGGAGGATCAGGACCAACTGCTTACCGCCGATACCGTTCCGGCGGAGGCTGAACAGGATCTGGAGAGATTCTTTGGCAACGAGGAGA 8 2 1 7.5 7 6 5 4 3 2.5 Probe A Probe B Probe C 7.5 3 2.5 1 N/N N/T 6 5 4 3 N/N N/T 8 7 5 4 2 N/N N/T AMD DDC CAT
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Bio D137 Human and Eukaryotic Genetics J.L.Marsh F'11
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 16

PS8-11 - Bio D137 Human and Eukaryotic Genetics Prob Set 8...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online