markov-chains-1

markov-chains-1 - Markov Chain Models (Part 1) BMI/CS 576

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Markov Chain Models (Part 1) BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Fall 2011 Motivation for sequence modeling tctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcaagttca accggaagaaaaccgtgacattttaacacgtttgttacaaggtaaaggcgacgccgc aaattaaaattttattgacttaggtcactaaatactttaaccaatataggcatagcg ttgtcataatcgacttgtaaaccaaattgaaaagatttaggtttacaagtctacacc catcctcgcaccagtcgacgacggtttacgctttacgtatagtggcgacaatttttt tccagtataatttgttggcataattaagtacgacgagtaaaattacatacctgcccg acagttatccactattcctgtggataaccatgtgtattagagttagaaaacacgagg atagtctcagagtcttgacctactacgccagcattttggcggtgtaagctaaccatt aactcaaggctgatacggcgagacttgcgagccttgtccttgcggtacacagcagcg ttactgtgaacattattcgtctccgcgactacgatgagatgcctgagtgcttccgtt tattctcaacaagattaaccgacagattcaatctcgtggatggacgttcaacattga aacgagtcaatcagaccgctttgactctggtattactgtgaacattattcgtctccg aagtgcttagcttcaaggtcacggatacgaccgaagcgagcctcgtcctcaatggcc gaagaccacgcctcgccaccgagtagacccttagagagcatgtcagcctcgacaact ccatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgctacat these sequences are E. coli promoters these sequences are not promoters How can we tell the difference? Is this sequence a promoter?
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Motivation for Markov models in computational biology there are many cases in which we would like to represent the statistical regularities of some class of sequences
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 8

markov-chains-1 - Markov Chain Models (Part 1) BMI/CS 576

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online