Intro-molbio - Introduction to Molecular Biology BMI/CS 576 www.biostat.wisc.edu/bmi576 Mark Craven [email protected] Fall 2011 Levels of the

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon
Introduction to Molecular Biology BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven [email protected] Fall 2011 Levels of the biological hierarchy Organelle Cell Tissue Organ Organism Population Ecosystem Molecule DNA, RNA, Protein, Lipids… Nucleus, Mitochondrion… Fat cell, Blood cell, Muscle cell… Adipose tissue, Blood, Nerve tissue… Heart, Lungs, Brain… Pine tree, Lizard, Human… Central Wisconsin Humans, Monona Muskie Lake Monona, Mojave desert, …
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The Central Dogma Our discussion is going to be focused on the Central Dogma DNA can be thought of as the “blueprint” for an organism composed of small molecules called nucleotides – four different nucleotides distinguished by the four bases : adenine (A), cytosine (C), guanine (G) and thymine (T) is a polymer : large molecule consisting of similar units (nucleotides in this case) a single strand of DNA can be thought of as a string composed of the four letters: A, C, G, T ctgctggaccgggtgctaggaccctgactgcccgggg ccgggggtgcggggcccgctgag
Background image of page 2
The double helix DNA molecules usually consist of two strands arranged in the famous double helix Watson-Crick base pairs in double-stranded DNA A always bonds to T C always bonds to G
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The alphabet of DNA: 4 bases G C A T The double helix each strand of DNA has a “direction” – at one end, the terminal carbon atom in the backbone is the 5’ carbon atom of the terminal sugar – at the other end, the terminal carbon atom is the 3’ carbon atom of the terminal sugar therefore we can talk about the 5’ and the 3’ ends of a DNA strand in a double helix, the strands are antiparallel (arrows drawn from the 5’ end to the 3’ end go in opposite directions)
Background image of page 4
image from the DOE Human Genome Program http://www.ornl.gov/hgmis image from the DOE Human Genome Program http://www.ornl.gov/hgmis
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Chromosomes DNA is packaged into individual chromosomes (along with proteins) prokaryotes (single-celled organisms lacking nuclei) typically have a single circular chromosome eukaryotes (organisms with nuclei) have a species- specific number of linear chromosomes DNA packing in eukaryotes
Background image of page 6
Image of page 7
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 12/15/2011 for the course BMI 576 taught by Professor Staff during the Fall '11 term at Wisc Green Bay.

Page1 / 24

Intro-molbio - Introduction to Molecular Biology BMI/CS 576 www.biostat.wisc.edu/bmi576 Mark Craven [email protected] Fall 2011 Levels of the

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online