Lecture8 - Lecture 8. Epigenetic reprogramming (Part II)...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
Lecture 8. Epigenetic reprogramming (Part II) Lisheng WANG lwang@uottawa.ca Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Most human iPS cells are made by viral vectors (such as retrovirus and lentivirus), which integrate the reprogramming factors into the host genomes and may increase the risk of tumor formation. I. Several new approaches to generate iPS cells II. microRNA and reprogramming III. Reprogram adult cells to adult stem cells – a new trend and current research progress Epigenetic reprogramming (Part II) – current progress
Background image of page 2
I. Several new approaches to generate iPS cells Keisuke Okita and Shinya Yamanaka. Phil. Trans. R. Soc. B (2011) 366, 2198–2207 (review)
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
I. Several new approaches to generate iPS cells Zhou, W. & Freed, C. R. Stem Cells 2009; 27, 2667–2674 Using adenovirus vectors Carry their genetic material in the form of double-stranded DNA. The genetic material of the adenoviruses is not incorporated (transient) into the host cell's genetic material. Not replicate when the host cells is undergoing cell division. As a result, treatment with the adenovirus will require re-administration in a growing cell population.
Background image of page 4
I. Several new approaches to generate iPS cells Fusaki, N., et al. Proc. Jpn. Acad. B Phys. Biol. Sci. 2009; 85: 348–362. Nishimura K, J Biol Chem. 2011 Feb 11;286(6):4760-4771 Using Sendai virus vectors Replicate in the form of negative-sense single stranded RNA in the cytoplasm of infected cells, which do not go through a DNA phase nor integrate into the host genome. Have been considered for clinical studies of gene therapy for cystic fibrosis, critical limb ischemia or vaccines for AIDS.
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
I. Several new approaches to generate iPS cells Junying Yu, et al. SCIENCE 2009; 324: 797 oriP/EBNA1 (Epstein-Barr nuclear antigen- 1)–based episomal vectors. Derived from the Epstein-Barr virus, oriP/ EBNA1 plasmids can be transfected without the need for viral packaging. If drug selection is subsequently removed, the episomes are lost at ~5% per cell generation owing to defects in plasmid synthesis and partitioning; thus, cells devoid of plasmids can be easily isolated. (Note: pEF: the eukaryotic elongation factor 1a promoter; pCMV: the cytomegalovirus immediate-early promoter)
Background image of page 6
Remove integrated transgenes - Cre/LoxP recombination The loxP site can be inserted on either side of a piece of DNA. (A) If Cre recombinase is expressed in the cell, the loxP site will be cut and joined together, removing the piece of DNA between the two sites. (B) Since the loxP site is directional, it can also be used to invert pieces of DNA which are between it. Here two loxP sites which are inserted on either side of a piece of DNA in opposite directions. Once Cre is expressed, the loxP sites are both cut and the piece of DNA inverted and reattached 34 bp LoxP sequence: ATAACTTCGTATAGCATACATTATACGAAGTTAT A. B.
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 25

Lecture8 - Lecture 8. Epigenetic reprogramming (Part II)...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online