Homework - base pairs on either side of the restriction...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
BioGD2810 Ungraded Homework The object of Quiz #11 was to produce pharmaceutically useful quantities of human growth hormone, for example to treat certain forms of dwarfism. (a) What kinds of DNA sequences must the vector pMAL-p4X contain that are not shown on Figure 1 but that would be necessary for high levels of hormone production? Where would these sequences have to be located on the vector? (b) The following is part of a cDNA sequence; this region contains the entire open reading frame for human growth hormone. Devise two PCR primers that could be used to clone the entire open reading frame (including the initiation codon) into pMAL-p4X cut with the restriction enzymes EcoRI and HindIII. The primers should each share 15 bases of homology with the cDNA, but the resulting PCR product should be as short as possible. You should know that these two restriction enzymes cannot cut DNA if the restriction site is directly at the end of a piece of DNA; instead, there must be 5 other
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: base pairs on either side of the restriction site for cleavage to occur. [This is a very difficult problem, but it will help you review a substantial amount of material thus far encountered in the course.] 5' CCGTCAATGTGACCTCCGATTTCGATCTGGGGGCATTCACCTACATTTTACAT 3' (c) What is the amino acid sequence of human growth hormone? (d) What is lacking from the cDNA sequence that you would ordinarily expect to find in a cDNA? (e) If you purified the fusion protein on an amylose (poly-maltose) resin and then treated the resin with Enterokinase, what are the first 5 amino acids (starting at the N terminus) of the protein released from the resin? (f) Can you think of an alternative strategy to clone exactly the same fragment of DNA into the vector in exactly the same place without using PCR? Hint: this cDNA is not very large....
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern