Homework - base pairs on either side of the restriction...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
BioGD2810 Ungraded Homework The object of Quiz #11 was to produce pharmaceutically useful quantities of human growth hormone, for example to treat certain forms of dwarfism. (a) What kinds of DNA sequences must the vector pMAL-p4X contain that are not shown on Figure 1 but that would be necessary for high levels of hormone production? Where would these sequences have to be located on the vector? (b) The following is part of a cDNA sequence; this region contains the entire open reading frame for human growth hormone. Devise two PCR primers that could be used to clone the entire open reading frame (including the initiation codon) into pMAL-p4X cut with the restriction enzymes EcoRI and HindIII. The primers should each share 15 bases of homology with the cDNA, but the resulting PCR product should be as short as possible. You should know that these two restriction enzymes cannot cut DNA if the restriction site is directly at the end of a piece of DNA; instead, there must be 5 other
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: base pairs on either side of the restriction site for cleavage to occur. [This is a very difficult problem, but it will help you review a substantial amount of material thus far encountered in the course.] 5' CCGTCAATGTGACCTCCGATTTCGATCTGGGGGCATTCACCTACATTTTACAT 3' (c) What is the amino acid sequence of human growth hormone? (d) What is lacking from the cDNA sequence that you would ordinarily expect to find in a cDNA? (e) If you purified the fusion protein on an amylose (poly-maltose) resin and then treated the resin with Enterokinase, what are the first 5 amino acids (starting at the N terminus) of the protein released from the resin? (f) Can you think of an alternative strategy to clone exactly the same fragment of DNA into the vector in exactly the same place without using PCR? Hint: this cDNA is not very large....
View Full Document

This note was uploaded on 12/20/2011 for the course BIOGD 6057 taught by Professor Fox during the Spring '09 term at Cornell University (Engineering School).

Ask a homework question - tutors are online