{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

110211class-prob

110211class-prob - Kozak consensus

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Names______________________________________________________ F11 ChE 170 In Class Problem Nov 1, 2011 In the sequence below, identify the most likely start codon, ribosomal binding site, and protein sequence produced by the gene. CACATATCTGGCTACTTAATCCCCATTCTGCCCCCGCGGTTACGCTTTCTTA TCTATTCTTTCAATCAGCACTTCACCCAATTCATCCTTAATTCTAATAACT
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: GGCTATTGCGCCTTACCTCGTGTTTTGTCTTTTTTTCATTACCAATGTGTGC ATGTGAGGAACAATATGGCACTGCAAAATGAGAAAAATAGTCGTTATCAA AAATAAGAGATCGATGCCTGATGTACAACCGTGTCGCATCCGACAAGGCAT CAGATCCCAATTCATTCCTGGAGCAGGAGTCATGTCATGAGTAAACTTTTG GATCGCTTTCGCTACTTCAAACAAAAGGGCGAAACCTTTGCCGA Kozak consensus...
View Full Document

{[ snackBarMessage ]}

Page1 / 2

110211class-prob - Kozak consensus

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online