110211class-prob

110211class-prob -...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Names______________________________________________________ F11 ChE 170 In Class Problem Nov 1, 2011 In the sequence below, identify the most likely start codon, ribosomal binding site, and protein sequence produced by the gene. CACATATCTGGCTACTTAATCCCCATTCTGCCCCCGCGGTTACGCTTTCTTA TCTATTCTTTCAATCAGCACTTCACCCAATTCATCCTTAATTCTAATAACT
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: GGCTATTGCGCCTTACCTCGTGTTTTGTCTTTTTTTCATTACCAATGTGTGC ATGTGAGGAACAATATGGCACTGCAAAATGAGAAAAATAGTCGTTATCAA AAATAAGAGATCGATGCCTGATGTACAACCGTGTCGCATCCGACAAGGCAT CAGATCCCAATTCATTCCTGGAGCAGGAGTCATGTCATGAGTAAACTTTTG GATCGCTTTCGCTACTTCAAACAAAAGGGCGAAACCTTTGCCGA Kozak consensus...
View Full Document

This note was uploaded on 12/29/2011 for the course CHE 170 taught by Professor Ceweb during the Fall '10 term at UCSB.

Page1 / 2

110211class-prob -...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online