111711ECB3e_Ch10

111711ECB3e_Ch10 - Essential Cell Biology Third Edition...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Essential Cell Biology Third Edition Chapter 10 Analyzing Genes and Genomes Copyright © Garland Science 2010 Job Opportunity at Amgen Patrick, I hope you are all doing well. I have been approved for a Life Sciences posi=on in the Pilot Plant. The posi=on is in the Upstream Area where we scale ­up bacterial and mammalian products. ODen in the past I looked for staff with very liFle experience. In this case, I am looking for someone with 1 ­2 years experience in the Life Sciences industry. Do any of you have any alumni networks that you could distribute this job descrip=on? The posi=on is not posted yet, so please ask anyone that is interested to send resumes directly to me at: [email protected] Thanks! Sperry (Sperry Brown) Chemical and Biological Engineers use recombinant DNA To modify cellular informa;on for various purposes. Laboratory evolu;on of proteins for:  ­ Tight binding to therapeu=c targets  ­ Stability to heat, chemicals, enzymes  ­ cellulose degrada=on  ­ light harves=ng  ­ detergents (sub=lisin)  ­ food processing  ­molecular biosensors (e.g Fluorescent proteins) Development of bacterial strains for  ­ bioremedia=on (break down of toxic chemicals) The Brain in Color  ­ produc=on of useful chemicals; ar=misinin Batteries Go Viral  ­ biosensing (bacterial canaries) Everyday plant virus and novel synthesis technique used to Virus engineering for materials synthesis improve battery performance Animal cell engineering for protein produc;on Development of transgenic plants and animals Synthetic Biology - Requires modification of cellular information A “Coliroid” UCSF / UT Austin Team Genome Biol. 2011 Oct 20;12(10):R102. The draft genome and transcriptome of Cannabis sativa. van Bakel H, Stout JM, Cote AG, Tallon CM, Sharpe AG, Hughes TR, Page JE. Banting and Best Department of Medical Research and Terrence Donnelly Centre for Cellular and Biomolecular Research, University of Toronto, 160 College St, Room 230, Toronto, ON, M5S 3E1, Canada. [email protected] J Exp Bot. 2009;60(13):3715-26. Epub 2009 Jul 6. Identification of candidate genes affecting Delta9-tetrahydrocannabinol biosynthesis in Cannabis sativa. Marks MD, Tian L, Wenger JP, Omburo SN, Soto-Fuentes W, He J, Gang DR, Weiblen GD, Dixon RA. Department of Plant Biology, University of Minnesota, St Paul, MN 55108, USA. [email protected] Disclaimer: This is NOT an endorsement of the recreational use of cannabis. Gene cloning and modifica;on of cellular informa;on For this class you should be able to explain how to clone a gene of interest, from any organism, into an appropriate expression host that can make the corresponding protein. Any organism Astrangia lajollensis From coast @ UCSB 1. Genomic or cDNA library 2. Copies of Gene of interest 3. Expression Plasmid Purify protein DNA Sequencing Restric;on enzymes typically recognize palindromic sequences and site specifically cut DNA • Restric=on ­modifica=on • Palindromes • Naming • Site Frequency • 4,6,8 cuFers • 2 types of overhangs • Typical rxn condi=on Figure 10-2 Essential Cell Biology (© Garland Science 2010) > 100 Known restriction enzymes Size separation of DNA fragments can be accomplished with agarose gel electrophoresis Soak gel in solution with fluorescent dye that binds DNA UV illumination e.g. ethidium bromide Figure 10-3 Essential Cell Biology (© Garland Science 2010) Figure 10-5 Essential Cell Biology (© Garland Science 2010) Figure 10-6 Essential Cell Biology (© Garland Science 2010) Figure 10-9 Essential Cell Biology (© Garland Science 2010) Plasmids are inserted into bacteria in process called transformation (Chemical or electroporation) cuveHe Recover cells Figure 10-10 Essential Cell Biology (© Garland Science 2010) Electroporator Plasmids Enter cells through transient pores Genes of interest can be isolated from a genomic library Gave rise to gene prospecting efforts: (e.g. Diversa) Problem: In eucaryotes, genes may be long with many introns Figure 10-11 Essential Cell Biology (© Garland Science 2010) A cDNA library represents all spliced mRNAs produced in a =ssue (They do not contain introns) Can iden=fy genes based upon their sequence or func=on by library screening or selec=on Many cDNA libraries are commercially available Figure 10-13 Essential Cell Biology (© Garland Science 2010) Differences between genomic and cDNA libraries Figure 10-14 Essential Cell Biology (© Garland Science 2010) The Polymerase Chain Reac;on can make many copies of a gene of interest, providing a source of a gene for cloning. Figure 10-15 Essential Cell Biology (© Garland Science 2010) Performing a PCR Components of a typical PCR reac;on 1.  2.  3.  4.  5.  6.  100s of rxns can be run in parallel Template DNA (usually many copies) Oligonucleo=de primers DNA polymerase/thermostable dNTPs Mg++ pH buffered salt solu=on Thermocycler Repeat 20 ­30 x Hybridiza;on or Annealing of DNA Figure 10-4 Essential Cell Biology (© Garland Science 2010) Each cycle of PCR doubles the number of copies Figure 10-16 Essential Cell Biology (© Garland Science 2010) PCR enables genera=on of desired genes if gene sequences are known Figure 10-17 Essential Cell Biology (© Garland Science 2010) PCR enables sensi;ve detec;on of viruses and bacteria in blood Figure 10-18 Essential Cell Biology (© Garland Science 2010) PCR is often used for forensic applications Figure 10-19a Essential Cell Biology (© Garland Science 2010) Figure 10-19b Essential Cell Biology (© Garland Science 2010) Ex. PCR. Design a primer to amplify the gene encoded by this DNA segment, and clone into vector with EcoR1 and EcoRV sites in MCS region 11401 11461 11521 11581 11641 11701 11761 11821 11881 acatgatgaa aaatttagct cgtgttctgg ggcttacgcg accgataaac ctgtctgatg atgggcaaaa atcgaacatg ctgaaagaac caggagggag tgccggatca tttatttcta ataacatgga ccgaaaaact aggaccacca cctacgatgg tctttgacga acgcctgatt ttaagtaatg agacggagaa cccgaaagcc tgagttgaaa ctcccgtttt ggtgtgcgaa cattcatcgc tttcaaaacc actttgctcc aatccactga caagttaatt atgacccccg aaagcgggcg gcggaaaaag caattcggcg atcagcttcc agcaatcacc attccgtgct aagccggtga tgaccgactt gctgtaccgt ttgatgtgct agctgcttaa tctggggtga tgattgacgc acgacgttgt ggctgcgctt tatcgcaccg! ccagggacag! acaggcctgc! gggtatcagc! ctttacgctc! aaagtccttc! tgatggcaaa! gctgaactgg! gcggccagca! Ex. PCR. Design a primer to amplify the gene encoded by this DNA segment, and clone into vector with EcoR1 and EcoRV sites in MCS region 11401 11461 11521 11581 11641 11701 11761 11821 11881 acatgatgaa aaatttagct cgtgttctgg ggcttacgcg accgataaac ctgtctgatg atgggcaaaa atcgaacatg ctgaaagaac caggagggag tgccggatca tttatttcta ataacatgga ccgaaaaact aggaccacca cctacgatgg tctttgacga acgcctgatt ttaagtaatg agacggagaa cccgaaagcc tgagttgaaa ctcccgtttt ggtgtgcgaa cattcatcgc tttcaaaacc actttgctcc aatccactga caagttaatt atgacccccg aaagcgggcg gcggaaaaag caattcggcg atcagcttcc agcaatcacc attccgtgct Coding strand (shown) is wriFen 5’ ­> 3’ aagccggtga tgaccgactt gctgtaccgt ttgatgtgct agctgcttaa tctggggtga tgattgacgc acgacgttgt ggctgcgctt tatcgcaccg! ccagggacag! acaggcctgc! gggtatcagc! ctttacgctc! aaagtccttc! tgatggcaaa! gctgaactgg! gcggccagca! STEP 1 Identify sequence identical to first 15-20 bases, starting with ATG 11401 11461 11521 11581 11641 11701 11761 11821 11881 gggag gatca ttcta atgga aaact cacca gatgg acatgatgaa aaatttagct cgtgttctgg ggcttacgcg accgataaac ctgtctgatg atgggcaaaa atcgaacatg ctgaaagaac caggagggag tgccggatca tttatttcta ataacatgga ccgaaaaact aggaccacca cctacgatgg tctttgacga acgcctgatt ttaagtaatg agacggagaa cccgaaagcc tgagttgaaa ctcccgtttt ggtgtgcgaa cattcatcgc tttcaaaacc actttgctcc aatccactga caagttaatt atgacccccg aaagcgggcg gcggaaaaag caattcggcg atcagcttcc agcaatcacc attccgtgct aagccggtga tgaccgactt gctgtaccgt ttgatgtgct agctgcttaa tctggggtga tgattgacgc acgacgttgt ggctgcgctt tatcgcaccg! ccagggacag! acaggcctgc! gggtatcagc! ctttacgctc! aaagtccttc! tgatggcaaa! gctgaactgg! gcggccagca! ttaagtaatg aatccactga aagccggtga agacggagaa caagttaatt tgaccgactt cccgaaagcc atgacccccg gctgtaccgt 5’- . . . A aaagcgggcg ttgatgtgct tgagttgaaaTGAATCCACTAAAAGCCGGT ctcccgtttt gcggaaaaag agctgcttaa ggtgtgcgaa caattcggcg tctggggtga cattcatcgc atcagcttcc tgattgacgc tatcg ccagg acagg gggta cttta aaagt tgatg STEP 2 TO THE 5’ END, add a Kozak (for eucaryote vector) or a Shine Dalgarno for a prokaryote vector. 5’- . . . GAGGAGACTGATTATGAATCCACTAAAAGCCGGT 5’- . . . ACCATGAATCCACTAAAAGCCGGT STEP 3 TO THE 5’ END, add the appropriate restriction enzyme site, and 5-10 bases of “overhang” to enable digestion. 5’- TCGAGGTGAATTCGAGGAGACTGATTATGAATCCACTAAAAGCCGGT 5’- TCGAGGTGAATTCACCATGAATCCACTAAAAGCCGGT 11401 acatgatgaa caggagggag ttaagtaatg aatccactga 11461 aaatttagct tgccggatca agacggagaa caagttaatt 11521 cgtgttctgg tttatttcta cccgaaagcc atgacccccg 11581 ggcttacgcg Reverse or 3’ Primer Design aaagcgggcg ataacatgga tgagttgaaa 11641 TEP 1 S accgataaac ccgaaaaact ctcccgtttt gcggaaaaag 11701 ctgtctgatg aggaccacca ggtgtgcgaa caattcggcg Identify reverse complement to stop codon, and ~15 11761 atgggcaaaa cctacgatgg cattcatcgc atcagcttcc bases immediately proceeding the stop codon. 11821 atcgaacatg tctttgacga tttcaaaacc agcaatcacc 11881 ctgaaagaac acgcctgatt actttgctcc attccgtgct GACTTTCTTG TGCGGACT 5’ - TCAGGCGTGTTCTTTCAG STEP 2 Append at 5’, restriction site and overhang 5’ - TGCATG GATATC TCAGGCGTGTTCTTTCAG aagcc tgacc gctgt ttgat agctg tctgg tgatt acgac ggctg Gene cloning and modifica;on of cellular informa;on For this class you should be able to explain how to clone a gene of interest, from any organism, into an appropriate expression host that can make the corresponding protein. Any organism Astrangia lajollensis From coast @ UCSB 1. Genomic or cDNA library 2. Copies of Gene of interest 3. Expression Plasmid Purify protein DNA Sequencing DNA sequencing uses dideoxy chain terminators Figure 10-20 Essential Cell Biology (© Garland Science 2010) Figure 10-21 Essential Cell Biology (© Garland Science 2010) Figure 10-22 Essential Cell Biology (© Garland Science 2010) Figure 10-23 Essential Cell Biology (© Garland Science 2010) Figure 10-24 Essential Cell Biology (© Garland Science 2010) Figure 10-28 Essential Cell Biology (© Garland Science 2010) Figure 10-29a Essential Cell Biology (© Garland Science 2010) Figure 10-29b Essential Cell Biology (© Garland Science 2010) Modification of fly neurons to to express GFP to enable their visualization Figure 10-30 Essential Cell Biology (© Garland Science 2010) Figure 10-34 (part 1 of 2) Essential Cell Biology (© Garland Science 2010) Figure 10-34 (part 2 of 2) Essential Cell Biology (© Garland Science 2010) Figure 10-35 Essential Cell Biology (© Garland Science 2010) Figure 10-36 Essential Cell Biology (© Garland Science 2010) Figure 10-36 (part 1 of 2) Essential Cell Biology (© Garland Science 2010) Figure 10-36 (part 2 of 2) Essential Cell Biology (© Garland Science 2010) Figure 10-37 Essential Cell Biology (© Garland Science 2010) Figure 10-38a Essential Cell Biology (© Garland Science 2010) Figure 10-38b,c Essential Cell Biology (© Garland Science 2010) ...
View Full Document

This note was uploaded on 12/29/2011 for the course CHE 170 taught by Professor Ceweb during the Fall '10 term at UCSB.

Ask a homework question - tutors are online