{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Sandra S. Diebold, et al_supplementary

Sandra S. Diebold, et al_supplementary - 1 Supporting...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Supporting Online Material Materials and Methods Reagents. LPS, polyU, polyG, polyI, polyC and polyA were from Sigma (Poole, UK). The CpG-containing phosphorothioate-linked oligonucleotide 1668 was made by Cancer Research UK. Influenza virus (A/PR/8/34; kind gift from Matthew Albert) was used live or after inactivation for 30 min at 56˚C or 1 h at 65˚C, as indicated. NS1 mutant virus (A/PR/8/34) was a kind gift from Hermann Unger and Andreas Grassauer. Influenza virus RNA was isolated from purified strain X31 virions (A/Aichi/2/68; kind gift from John Skehel) by SDS lysis followed by phenol/chloroform extraction. GFP RNA was synthesized from a T7-GFP PCR fragment (942 bp) using the T7 MegaScript Kit from Ambion with or without cap analogue, as indicated. GFP RNA containing a 3’ polyA tail (64 bases long) was synthesised from pGEM4Z/GFP ( 1 ) (kind gift from Alexander Steinkasserer, Erlangen). Polyethylenimine was purchased from Aldrich (2 kD PEI) or Qbiogene (jetPEI). Non-fusogenic liposomes were prepared by sonication of 90% DOPC and 10% cholesterol in PBS ± polyU. RNA oligonucleotides of the type used for RNA interference experiments were purchased from Xeragon (Zürich, Switzerland). RNA oligo1 has the sequence 5’ caucucauuauccuuugguuu 3’ and RNA oligo 2 is 5’ accaaaggauaaugagauguu 3’ . Cells. C57BL/6 mice were obtained from Charles River (Margate, UK). BALB/c and MyD88 –/– mice ( 2 ) were bred at Cancer Research UK. TLR7 –/– mice ( 3 ) were bred at the Research Institute for Microbial Diseases. PDC were purified from splenocyte suspensions as described ( 4 ). Flt3L-DC were generated as described ( 5 ) in RPMI 1640 medium containing 10% FCS, 2 mM glutamine, 50 μM 2-mercaptoethanol, 100 units/ml penicillin, 100 μg/ml streptomycin and murine Flt3L (R&D Systems; 50 ng/ml) and were used at day
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
2 10 or 11 of culture. For purification of B220 + and CD11b + DC, cells from Flt3L cultures were incubated with anti-B220 MACS beads and separated on an AutoMACS instrument (Miltenyi Biotec, Bisley, UK).
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern