423f11-gibbs

423f11-gibbs - Motif Finding CMSC 423 DNA -> mRNA ->...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
Motif Finding CMSC 423
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
DNA -> mRNA -> Protein TSS Gene Intron : not translated Exon : translated Upstream region TF Binding sites Transcription factor DNA polymerase DNA Finding transcription factor binding sites can tell us about the cell’s regulatory network.
Background image of page 2
Transcription Network 169 transcription factors (excluding sigmas) 3322 edges 1753 activation , 1369 repression , 185 b oth , 3 unknown
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
RNA Polymerase b/c it makes RNA into a polymer is an enzyme Discovered in 1960; Nobel prize for its discovery in 1959. .. oops 1959 Nobel awarded to Severo Ochoa and Arthur Kornberg for discovering what was mistakenly believed to be RNA pol. 2006 Nobel awarded to Roger Kornberg (son of Arthur) for detailed structure of RNA pol. 1960 Sam Weiss and Jared Hurwitz discover the real RNA pol. Image of transcription occurring. Each “hair” is a piece of RNA that RNA pol is growing off of the DNA.
Background image of page 4
Transcription Factor Binding Sites RegulonDB (Feb 27, 2010) Length of E. coli K12 TF binding sites
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Transcription Factor Binding Sites RegulonDB (Feb 27, 2010)
Background image of page 6
Motif Finding Given p sequences, ±nd the most mutually similar length- k subsequences, one from each sequence: dist(s i ,s j ) = Hamming distance between s i and s j . 1. ttgccacaaaataatccgccttcgcaaattgacc TACCTCAATAGCGGTA gaaaaacgcaccactgcctgacag 2. gtaagtacctgaaagttacggtctgcgaacgctattccac TGCTCCTTTATAGGTA caacagtatagtctgatgga 3. ccacacggcaaataaggag TAACTCTTTCCGGGTA tgggtatacttcagccaatagccgagaatactgccattccag 4. ccatacccggaaagagttactccttatttgccgtgtggttagtcgctt TACATCGGTAAGGGTA gggattttacagca 5. aaactattaagatttttatgcagatgggtattaagga GTATTCCCCATGGGTA acatattaatggctctta 6. ttacagtctgttatgtggtggctgttaa TTATCCTAAAGGGGTA tcttaggaatttactt Transcription factor argmin s 1 ,...,s p X i<j dist( s i ,s j ) Hundreds of papers, many formulations (Tompa05)
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Motif-Fnding by Gibbs Sampling “Gibbs sampling” is the basis behind a general class of algorithms that is a type of local search. It doesn’t guarantee good performance, but often works well in
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/13/2012 for the course CMSC 423 taught by Professor Staff during the Fall '07 term at Maryland.

Page1 / 20

423f11-gibbs - Motif Finding CMSC 423 DNA -&gt; mRNA -&gt;...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online