423f11-lec1

423f11-lec1 - CMSC 423: Bioinformatics Introduction What...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
CMSC 423: Bioinformatics Introduction
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
What does biology have to do with computers? Huge amount of data: too much to analyze by hand, lots of mystery left about how life works. Requires clever algorithms to: Fnd interesting patterns store / search / compare visualize vast collections of data predict missing or hard-to-observe features (like protein structure or evolutionary relationships) Nearly all molecular biology is now “computational biology”: biologists depend on computer scientists every day.
Background image of page 2
A midterm exam (30%) : October 20th The date is fxed. Exam will cover material up through october 13th. Comprehensive fnal (30%) : Tuesday, Dec 20, 2010 1:30pm - 3:30pm. Covers everything in the class Several homework assignments. 20% oF your grade Neatness counts Programming project: 20% oF your grade. Details in a Few weeks. Java. Almost certainly in small groups.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Administrative Details TA: Darya Filippova TA of±ce hours: Instructor of±ce hours: Mondays 4-5pm, or by appointment, in CBCB 3113. Grades will be posted on: http://grades.cs.umd.edu More details on syllabus handout. Homeworks are due at the start of class on their due dates. No late homeworks will be accepted. You can discuss homeworks with your classmates. You must list the names of the people with whom you collaborated at the top of the homework. You must write up homeworks solutions on your own . Late programming assignments will lose 10% per day, up to 5 days, after which they will not be accepted.
Background image of page 4
Computational Successes: 1. Genome assembly 2. Gene discovery 3. Understanding the origin of swine flu 4. Predicting protein structure
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Genome assembly
Background image of page 6
Genome of the Cow a sequence of 2.86 billion letters enough letters to Fll a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG AACTGCAATCCATCCTTTTTGCCATCTTCCTCTTTGCCTATGTGATCACAGTCGGGGGCAACTTGAGTATCCTG GCCGCCATCTTTGTGGAGCCCAAACTCCACACCCCCATGTACTACTTCCTGGGGAACCTTTCTCTGCTGGACAT TGGGTGCATCACTGTCACCATTCCTCCCATGCTGGCCTGTCTCCTGACCCACCAATGCCGGGTTCCCTATGCAG CCTGCATCTCACAGCTCTTCTTTTTCCACCTCCTGGCTGGAGTGGACTGTCACCTCCTGACAGCCATGGCCTAC GACCGCTACCTGGCCATTTGCCAGCCCCTCACCTATAGCATCCGCATGAGCCGTGACGTCCAGGGAGCCCTGGT GGCCGTCTGCTGCTCCATCTCCTTCATCAATGCTCTGACCCACACAGTGGCTGTGTCTGTGCTGGACTTCTGCG GCCCTAACGTGGTCAACCACTTCTACTGTGACCTCCCGCCCCTTTTCCAGCTCTCCTGCTCCAGCATCCACCTC AACGGGCAGCTACTTTTCGTGGGGGCCACCTTCATGGGGGTGGTCCCCATGGTCTTCATCTCGGTATCCTATGC CCACGTGGCAGCCGCAGTCCTGCGGATCCGCTCGGCAGAGGGCAGGAAGAAAGCCTTCTCCACGTGTGGCTCCC ACCTCACCGTGGTCTGCATCTTTTATGGAACCGGCTTCTTCAGCTACATGCGCCTGGGCTCCGTGTCCGCCTCA GACAAGGACAAGGGCATTGGCATCCTCAACACTGTCATCAGCCCCATGCTGAACCCACTCATCTACAGCCTCCG GAACCCTGATGTGCAGGGCGCCCTGAAGAGGTTGCTGACAGGGAAGCGGCCCCCGGAGTG . ..
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The Cat only grinned when it saw Alice. when it saw Alice. It looked
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 28

423f11-lec1 - CMSC 423: Bioinformatics Introduction What...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online