423f11-lec6-sequencing

423f11-lec6-sequencing - Genome Sequencing CMSC 423 Carl...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
Genome Sequencing CMSC 423 Carl Kingsford
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Genome Sequencing ACCGTCCAATTGG. .. TGGCAGGTTAACC. .. E.g. human: 3 billion bases split into 23 chromosomes gacgatcggtttatcc ctgctagccaaataggctaatactacgga DNA polymerase : enzyme that will grow a complementary DNA strand. Main tool of traditional sequencing: DNA Synthesis
Background image of page 2
Sanger Sequencing: Finding the As gacgatcgg ttt A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A tt A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A tt A tg A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A tt A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A tt A tg A * ctgctagcc aaa T aggc T aa T ac T acgga gacgatcgg ttt A tccg A * ctgctagcc aaa T aggc T aa T ac T acgga t t t t a a a a g g g g c c c c a * dXTP ddATP
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Size Sequence gacgatcgg ttt A * gacgatcgg ttt A tccg A * gacgatcgg ttt A *
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/13/2012 for the course CMSC 423 taught by Professor Staff during the Fall '07 term at Maryland.

Page1 / 11

423f11-lec6-sequencing - Genome Sequencing CMSC 423 Carl...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online