Lec02-seqalign

Lec02-seqalign - CMSC 423: Sequence Alignment Slides By:...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: CMSC 423: Sequence Alignment Slides By: Carl Kingsford Department of Computer Science University of Maryland, College Park Based on Section 6.6 of Algorithm Design by Kleinberg & Tardos. The Problem Given: Two strings a = a 1 a 2 a 3 a 4 . . . a m b = b 1 b 2 b 3 b 4 . . . b n a i , b i L for some alphabet L like { A , C , G , T } . Compute how similar the two strings are. What do we mean by similarity between two strings? Alignment Examples prin-ciple |||| |||XX prinncipal (1 gap, 2 mm) misspell ||| |||| mis-pell (1 gap) aa-bb-ccaabb |X || | | | ababbbc-a-b- (5 gaps, 1 mm) prin-cip-le |||| ||| | prinncipal- (3 gaps, 0 mm) prehistoric ||||||||---historic (3 gaps, 0 mm) al-go-rithm- || XX ||X | alKhwariz-mi (4 gaps, 3 mm) Motivation Alignment is used extensively in molecular biology, where a and b are the DNA sequences of two genes (see NCBI BLAST) Spell checkers Inexact search of web pages NCBI BLAST NCBI BLAST Alignment >gb|AC115706.7| Mus musculus chromosome 8, clone RP23-382B3, complete sequence Query 1650 gtgtgtgtgggtgcacatttgtgtgtgtgtgcgcctgtgtgtgtgggtgcctgtgtgtgt 1709 |||||||||| | || | ||||||||| | |||||||| ||| || ||||| Sbjct 56838 GTGTGTGTGGAAGTGAGTTCATCTGTGTGTGCACATGTGTGTGCA--TGCATGCATGTGT 56895 Query 1710 gtg-gggcacatttgtgtgtgtgtgtgtgcctgtgtgtgggtgcacatttgtgtgtgtgc 1768 || ||||| || ||| ||||||| |||||||| ||| ||| ||||| || | Sbjct 56896 GTCCGGGCA------TGCATGTCTGTGTGCATGTGTGTGTGTGTGCAT--GTGTGAGTAC 56947 Query 1769 ctgtgtgtgtgtgcctgtgtgtgggggtgcacatttgtgtgtgtgtgtgcctgtgtgtgg 1828 |||||||||| ||| ||| |||| | ||| ||| ||||| |||||| ||||| | Sbjct 56948 CTGTGTGTGTATGCTTGTATGTGTGTGTGTGCATGTGTGTAGGTGTGTATATGTGTAAGT 57007 Query 1829 gggtgcacatttgtgtgtgtgtgtgcctgtgtgtgtgggtgcacatttgtgtgtgtgtgt 1888 ||| ||||||| |||||| |||| | ||| |||| |||||||||| || Sbjct 57008 T------CATCTGTGTGTATGTGTG--TGTGAGAGTGCATGCA----TGTGTGTGTGAGT...
View Full Document

This note was uploaded on 01/13/2012 for the course CMSC 423 taught by Professor Staff during the Fall '07 term at Maryland.

Page1 / 26

Lec02-seqalign - CMSC 423: Sequence Alignment Slides By:...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online