Lec09-bwt - Burrows-Wheeler Transform CMSC 423 Genome of...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon
Burrows-Wheeler Transform CMSC 423
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Genome of the Cow a sequence of 2.86 billion letters enough letters to Fll a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG AACTGCAATCCATCCTTTTTGCCATCTTCCTCTTTGCCTATGTGATCACAGTCGGGGGCAACTTGAGTATCCTG GCCGCCATCTTTGTGGAGCCCAAACTCCACACCCCCATGTACTACTTCCTGGGGAACCTTTCTCTGCTGGACAT TGGGTGCATCACTGTCACCATTCCTCCCATGCTGGCCTGTCTCCTGACCCACCAATGCCGGGTTCCCTATGCAG CCTGCATCTCACAGCTCTTCTTTTTCCACCTCCTGGCTGGAGTGGACTGTCACCTCCTGACAGCCATGGCCTAC GACCGCTACCTGGCCATTTGCCAGCCCCTCACCTATAGCATCCGCATGAGCCGTGACGTCCAGGGAGCCCTGGT GGCCGTCTGCTGCTCCATCTCCTTCATCAATGCTCTGACCCACACAGTGGCTGTGTCTGTGCTGGACTTCTGCG GCCCTAACGTGGTCAACCACTTCTACTGTGACCTCCCGCCCCTTTTCCAGCTCTCCTGCTCCAGCATCCACCTC AACGGGCAGCTACTTTTCGTGGGGGCCACCTTCATGGGGGTGGTCCCCATGGTCTTCATCTCGGTATCCTATGC CCACGTGGCAGCCGCAGTCCTGCGGATCCGCTCGGCAGAGGGCAGGAAGAAAGCCTTCTCCACGTGTGGCTCCC ACCTCACCGTGGTCTGCATCTTTTATGGAACCGGCTTCTTCAGCTACATGCGCCTGGGCTCCGTGTCCGCCTCA GACAAGGACAAGGGCATTGGCATCCTCAACACTGTCATCAGCCCCATGCTGAACCCACTCATCTACAGCCTCCG GAACCCTGATGTGCAGGGCGCCCTGAAGAGGTTGCTGACAGGGAAGCGGCCCCCGGAGTG . ..
Background image of page 2
The Cat only grinned when it saw Alice. when it saw Alice. It looked good-natured, she thought, still sti1l it had very long claws good-natured, she thought: still a greet many so she felt that it ought be treated with respect. Cat only It looked good- claws and a great many teeth, so she ought to be treated We can only read ~ 1000 characters at a time from a random place:
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The Cat only grinned when it saw Alice. when it saw Alice. It looked good-natured, she thought, still sti1l it had very long claws good-natured, she thought: still a greet many so she felt that it ought be treated with respect. Cat only It looked good- claws and a great many teeth, so she ought to be treated ...except with 35 million pieces It’s a jigsaw puzzle . ..
Background image of page 4
A Cow Genome Sequencing technologies produce millions of “reads” = a random, short substring of the genome If we already know the genome of one cow, we can get reads from a 2nd cow and map them onto the known cow genome. Need to do millions of string searches in a long string.
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 6
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/13/2012 for the course CMSC 423 taught by Professor Staff during the Fall '07 term at Maryland.

Page1 / 19

Lec09-bwt - Burrows-Wheeler Transform CMSC 423 Genome of...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online