{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

5Find the Gene - 6 circle the start codon(on the mRNA and...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Find That Gene! Locate the gene within the DNA sequence below by identifying and labeling the regulatory sequences and transcriptional and translational landmarks. Note: geneticists (and their students) read genes 5’ to 3’ as standard practice—the cell’s machinery, however, may be reading the complimentary sequence on the other strand, but that’s their problem and shouldn’t concern you. Identify the following features on the DNA sequence and label as indicated: 1. label each DNA strand as either template or non-template 2. label the promoter sequence on the DNA (look for 5’-TATA-3’) 3. place an arrow at the DNA nucleotide representing the transcription start site (the first nucleotide transcribed) 4. place an arrow at the DNA nucleotide representing the transcription stop site (the last nucleotide transcribed) 5. fill in the missing RNA nucleotides in the mRNA sequence
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 6. circle the start codon (on the mRNA and DNA) and set the reading frame by underlining each subsequent triplet 7. place a square around the stop codon on the mRNA and DNA 8. bracket the coding region on both the DNA and RNA 9. label the UTRs (untranslated regions) of the mRNA 10. underline and label the poly(A) signal (on both the DNA and mRNA) 11. write the amino acid sequence of the polypeptide (use the standard three letter abbreviations) DNA 5’ …TCTATAAAAGTACCCGTCTTGGGATATGGTTATGCCG……ATCGATTTCATCTAAGGTAACCCCAAATAAACTGCAAC… 3’ 3’ …AGATATTTTCATGGGCAGAACCCTATACCAATACGGC……TAGCTAAAGTAGATTCCATTGGGGTTTATTTGACGTTG… 5’ mRNA (note: it is vertically aligned with DNA sequence above for ease of comparison) 5’UCUUGGGAU------------……------------------AACCCCAAAUAAACUGC 3’ Polypeptide...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern