5Find the Gene

5Find the Gene - 6 circle the start codon(on the mRNA and DNA and set the reading frame by underlining each subsequent triplet 7 place a square

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Find That Gene! Locate the gene within the DNA sequence below by identifying and labeling the regulatory sequences and transcriptional and translational landmarks. Note: geneticists (and their students) read genes 5’ to 3’ as standard practice—the cell’s machinery, however, may be reading the complimentary sequence on the other strand, but that’s their problem and shouldn’t concern you. Identify the following features on the DNA sequence and label as indicated: 1. label each DNA strand as either template or non-template 2. label the promoter sequence on the DNA (look for 5’-TATA-3’) 3. place an arrow at the DNA nucleotide representing the transcription start site (the first nucleotide transcribed) 4. place an arrow at the DNA nucleotide representing the transcription stop site (the last nucleotide transcribed) 5. fill in the missing RNA nucleotides in the mRNA sequence
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 6. circle the start codon (on the mRNA and DNA) and set the reading frame by underlining each subsequent triplet 7. place a square around the stop codon on the mRNA and DNA 8. bracket the coding region on both the DNA and RNA 9. label the UTRs (untranslated regions) of the mRNA 10. underline and label the poly(A) signal (on both the DNA and mRNA) 11. write the amino acid sequence of the polypeptide (use the standard three letter abbreviations) DNA 5’ …TCTATAAAAGTACCCGTCTTGGGATATGGTTATGCCG……ATCGATTTCATCTAAGGTAACCCCAAATAAACTGCAAC… 3’ 3’ …AGATATTTTCATGGGCAGAACCCTATACCAATACGGC……TAGCTAAAGTAGATTCCATTGGGGTTTATTTGACGTTG… 5’ mRNA (note: it is vertically aligned with DNA sequence above for ease of comparison) 5’UCUUGGGAU------------……------------------AACCCCAAAUAAACUGC 3’ Polypeptide...
View Full Document

This note was uploaded on 01/17/2012 for the course BIOL 303 taught by Professor Pfau,r during the Fall '08 term at Tarleton.

Ask a homework question - tutors are online