Genetics Final 2008 Spring pg 3

Genetics Final 2008 Spring pg 3 -...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
11. Which of the following evolutionary processes can constrain (limit) population divergence? a. selection b. genetic drift c. migration d. both b and c e. none of the above 12. Which of the following techniques can be used to quantify RNA expression from a tissue sample? a. cloning b. sequencing c. Western blot d. Northern blot e. Both a and c 13. Which of the following are components of variation in phenotypes? a. Additive genetic variance b. environmental variance c. epistatic variance d. dominance variance e. all of the above Given the DNA sequence below answer questions 14-16.
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: CTTATGTATTGCATTAGGCTCCCAATCCCGTACTGAAAACTG GAATACATAACGTAATCCGAGGGTTAGGGCATGACTTTTGAC 14. The bottom strand gets transcribed from left to right starting with the first base. How many amino acids would the protein contain when this RNA molecule was translated? a. 8 b. 9 c. 10 d. 11 e. 12 15. Which end of the top strand is the 5 end? a. left b. right 16. If the replication fork moves from right to left, which strand is the leading strand? a. top b. bottom...
View Full Document

Ask a homework question - tutors are online