Genetics Final 2008 Spring pg 8

Genetics Final 2008 Spring pg 8 - 1: TGAGGTCGGACTATTTAGCAT...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
28. Use the five DNA sequences shown below to determine the evolutionary relationships of the organisms. Use the UPGMA method to build a phylogenetic tree. (5)
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1: TGAGGTCGGACTATTTAGCAT 2: TGAGCCCGGTGTATTAACCAT 3: TGTGGTCCGACTATTTAGCAT 4: TGCGGGCGGACAATTTATCAT 5: TGAGCCCCGTGTAATAATCAT...
View Full Document

This note was uploaded on 01/19/2012 for the course PCB 3063C taught by Professor Mattgilg during the Fall '10 term at UNF.

Ask a homework question - tutors are online