Genetics Final Summer 2008 pg 5

Genetics Final Summer 2008 pg 5 - 23 Which of the following...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 23. Which of the following mechanisms of gene regulation is not found in prokaryotes? a. b. c. d. e. positive control negative control protein turnover differential splicing all of the above 24. In the DNA sequence shown below the bottom strand is the template strand of a gene. Which direction would RNA polymerase move along this sequence? 3’ – TATAAGCGGCCTTTAGTGGCACCTTAAACGTAGGC – 5’ 5’ – ATATTCGCCGGAAATCACCGTGGAATTTGCATCCG – 3’ a. b. c. d. right left none of the above all of the above 25.
How
many
amino
acids
would
the
protein
encoded
by
the
mRNA
in
question
24
include?
 
 a. 4
 b. 5
 c. 6
 d. 7
 e. 8
 
 
 26.

Using
the
data
set
below,
calculate
the
broad
sense
heritability
of
this
trait.
 
 Category
 
 Variance
 Environmental
 
 32.7
 
 
 Genotypic
 
 59.1
 
 a. 0.644
 b. 0.591
 c. 0.415
 d. 0.327
 e. 0
 
 
 ...
View Full Document

This note was uploaded on 01/19/2012 for the course PCB 3063C taught by Professor Mattgilg during the Fall '10 term at UNF.

Ask a homework question - tutors are online