
section8 - MIT Department of Biology 7.014 Introductory...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Recitation Section 8 March 2-3, 2005 Molecular Biology—Transcription and Translation Today we return to take another look at the yeast cystathionine beta synthase (CBS) protein. Below is the sequence of the yeast CBS gene and surrounding DNA. We will use this sequence for parts A and B of today’s section. The sequences of both strands of the DNA duplex are shown: the top strand reads 5' to 3' left to right (1 to 2040); the bottom, complimentary, strand reads 5' to 3' right to left (2040 to 1). 5’- CAACTTCACCCAAGTAAGGATAATCAGCTCTGTCGTGACTGATAAATGC TATAT CCGGCA 1 ---------+---------+---------+---------+---------+---------+ ± 3’- GTTGAAGTGGGTTCATTCCTATTAGTCGAGACAGCACTGACTATTTACG ATATA GGCCGT ± TATGCAGTCCACACGGCATTACCGTTTCACTAATTTATTGCCATCTTCCTCCACAGTTTT ± 61 ---------+---------+---------+---------+---------+---------+ ± ATACGTCAGGTGTGCCGTAATGGCAAAGTGATTAAATAACGGTAGAAGGAGGTGTCAAAA ± GCACCGAAAGGAAAAAAAGAAACCAACACCGAAAATTTTTTTCTCCTAAAGGTTAAAGTA ± 121 ---------+---------+---------+---------+---------+---------+ ± CGTGGCTTTCCTTTTTTTCTTTGGTTGTGGCTTTTAAAAAAAGAGGATTTCCAATTTCAT ± AACGCAAGGCACTTCACCAGGCTTG TATATAT AAATGTCGTGATGCTTCTATGCCAAAGT ± 181 ---------+---------+---------+---------+---------+---------+ ± TTGCGTTCCGTGAAGTGGTCCGAAC ATATATA TTTACAGCACTACGAACATACGGTTTCA ± AAAAGGCAACACTTGAAGATTTCGTTGTAGGCCACTTGCTCAAAGGACATCTAGATAAAT ± 241 ---------+---------+---------+---------+---------+---------+ ± TTTTCCGTTGTGAACTTCTAAAGCAACATCCGGTGAACGAGTTTCCTGTAGATCTATTTA ± ACGACGTAAGAATAAAAATGACTAAAT CT GAGCAGCAA G CCGATTCAAGACATAACGTTA ± 301 ---------+---------+-------- c +-------- b +---------+--- a -----+ ± TGCTGCATTCTTATTTTTACTGATTTA GA CTCGTCGTT C GGCTAAGTTCTGTATTGCAAT ± TCGACTTAGTTGGTAACACCCC A TTGATCGCACTGAAAAAATTGCCTAAGGCTTTGGGTA ± 361 ---------+---- e ----+-- d ------+---------+---------+---------+ ± AGCTCAATCAACCATTGTGGGG T AACTAGCGTGACTTTTTTAACGGATTCCGAAACCCAT ± TCAAACCACAAATTTATGCTAAGCTGGAACTATACAATCCAGGTGGTTCCATCAAAGACA ± 421 ---------+---------+---------+---------+---------+---------+ ± AGTTTGGTGTTTAAATACGATTCGACCTTGATATGTTAGGTCCACCAAGGTAGTTTCTGT ± GAATTGCCAAGTCTATGGTGGAAGAAGCTGAAGCTTCCGGTAGAATTCATCCTTCCAGAT ± 481 ---------+---------+---------+---------+---------+---------+ ± CTTAACGGTTCAGATACCACCTTCTTCGACTTCGAAGGCCATCTTAAGTAGGAAGGTCTA ± CTACTCTGATCGAACCTACTTCTGGTAACACCGGTATCGGTCTAGCTTTAATCGGCGCCA ± 541 ---------+---------+---------+---------+---------+---------+ ± GATGAGACTAGCTTGGATGAAGACCATTGTGGCCATAGCCAGATCGAAATTAGCCGCGGT ±
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 8

section8 - MIT Department of Biology 7.014 Introductory...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online