{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

section12 - 4 What does the mutant nomenclature(m1 m2 etc...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Recitation Section 12 March 16-17, 2005 Molecular Biology Review a b c A. Representations d e 5’ 3’ 3’ 5’ 5’AACGCAAGGCACTTCACCAGGCTTGTATATATAAATGTCGTGATGCTTCTATGCCAAAGTAAAAGGCAACACTTGAAGATTTCGTTGTAGGCC3’ f 3’TT GCGTTCCGTGAAGTGGTCCGAACATATATATTTACAGCACTACGAACATACGGTTTCATTTTCCGTTGTGAACTTCTAAAGCAACATCCGG5’ P A + A + N - P N + P XYZ + O + P A + A + N + P N + P XYZ + O + h P A + A - N + P N + P XYZ + O + g i j 1. What molecule is represented in each figure? 2. In figure e, what do vertical lines represent? 3. How do all these representations relate to each other?
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 4. What does the mutant nomenclature (m1, m2, etc) mean in terms of representations above? N N NH 2 N N H H H O O P O O O P O P O O O O O H OH H Image credits: (a) Courtesy of NASA, adapted by OCW. (b) Courtesy of the National Human Genome Research Institute, adapted by OCW. (c) Courtesy of the National Cancer Institute, adapted by OCW. (d) Courtesy of OCW. (i) Courtesy of the U.S. Department of Energy Human Genome Program (j) Courtesy of OCW. All other images are by the author. Base...
View Full Document

{[ snackBarMessage ]}