{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Lecture15 - Gene Expression and Regulation Lecture 15 DNA...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Lecture 15: DNA Microarray Technology Down Up mRNA level Some slides adapted from slides created by Dr. Jaideep Chaudhary Gene Expression and Regulation § Genes are differentially expressed in... • Different cell types (e.g. muscle cells, fibroblasts) • Environmental conditions (e.g. heat shock, nutrient deprivation) • Developmental phases (e.g. embryonic day 10 [e10]) • Cell-cycle stages (e.g. G1 phase) • Disease states (e.g. tumor cells, virus-infected cells) § Gene expression is primarily regulated at the level of transcription § Hence, the number of mRNA copies in a cell for a particular gene is a good indicator of that gene’s expression (number of proteins) § Dynamic range of mRNA levels: • Highly expressed genes can have up to 9400 mRNA copies per cell • Poorly expressed genes can have < 0.3 mRNA copies per cell DNA Microarray Experiments § Objective : Measure the number of mRNA molecules coded by each gene in the genome § Advantages of DNA microarray experiments: • Lack information a priori of which genes may have altered mRNA levels in a particular experimental condition • Knowledge of patterns of genes with altered mRNA levels is usually more informative than knowledge of single genes with altered mRNA levels • Use statistical analysis of microarray data to test hypotheses or generate new hypotheses Mechanics of DNA Microarrays complex mixture of mRNA molecules Gene 1 Gene 2 ...Gene 6200 ATGCCGAATCGTCCAGTAACC UACGGCUUAGCAGGUCAUUGG Fluorescent Dye
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
The Mechanics of a DNA Microarray Experiment § Isolate mRNA from cell cultures § Reverse Transcribe mRNA into cDNA § Label cDNA or cRNA by incorporating fluorescently-labeled nucleotides § Hybridize labeled cDNA (or cRNA) to DNA microarray § Wash and scan microarray in confocal laser scanner § Analyze data
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}