Lecture17 - Lecture 17 High-throughput sequencing...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Lecture 17: High-throughput sequencing technology and RNA-seq data analysis § High-throughput Sequencing Technologies • Solexa sequencing • Pyrosequencing (454 sequencing) § RNA-seq data analysis Mechanics of DNA Microarrays complex mixture of mRNA molecules Gene 1 Gene 2 ...Gene 6200 ATGCCGAATCGTCCAGTAACC UACGGCUUAGCAGGUCAUUGG Fluorescent Dye High-throughput Sequencing of mRNAs complex mixture of mRNA molecules cDNA High-throughput sequencing § High-throughput sequencing enables one to measure gene expression (mRNA levels) by simply counting the number of sequence reads for each mRNA/gene § Modern high-throughput sequencing technologies can generate millions of short sequence reads § Currently, two high-throughput sequencing technologies predominate (1) Solexa/Illumina sequencing uses reversible dNTP Terminators • A single run of Solexa sequencing typically generates ~1 to 5 million individual sequence reads • Each sequence read is relatively short (~35 nucleotides in length) (2) 454 sequencing uses a pyrosequencing approach • Pyrosequencing is ‘sequencing by synthesis’, and detects the release of the pyrophosphate following the addition of a nucleotide to DNA during DNA synthesis. • 454 sequencing is array based by pyrosequencing • 454 sequencing can generate 400,000 to 1 million individual sequence reads in a single run • Each sequence read is relatively long (~200 - 400 nucleotides in length) High-throughput Sequencing (HTSeq) Technologies
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Sanger sequencing and HTSeq: a comparison Shendure, J. and Ji, H. (2008) Nature Biotechnology 26 , 1135 - 1145 Sanger sequencing High Throughput Seq Solexa High-Throughput Sequencing Protocol Cluster Generation § Ligate adapters to ends of double stranded cDNAs cDNA Adapters Bind cDNA to surface
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/20/2012 for the course MBIOS 478 taught by Professor Staff during the Fall '11 term at Washington State University .

Page1 / 5

Lecture17 - Lecture 17 High-throughput sequencing...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online