Lecture2 - R e g u la tio n o f E u k a r y o tic G e n e E...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Lecture 2: Gene Prediction § Regulation of Gene Expression • Promoter Elements • Codon Usage (CAI values) § Gene Prediction • Prokaryotic Genes • Eukaryotic Genes § Comparative Genomics DNA primary RNA transcript mRNA protein active/ inactive protein mRNA transcriptional control translation control post- translational control transport control mRNA stability control NUCLEUS CYTOSOL nuclear envelope 1 4 RNA processing control 2 3 6 5 Regulation of Eukaryotic Gene Expression Gene Organization : Prokaryotes and Simple Eukaryotes Promoter Open reading frame (ORF) ATG Stop Transcribed Region Gene Elements : § An open reading frame (ORF) • Start codon (AUG) • Intervening codons • Stop codon (UAA, UAG, UGA) § A promoter • DNA sequences that regulate the transcription of the gene TATA box Core Promoter Distal Promoter Promoter DNA elements in Transcriptional Control Transcription Factor Proteins Transcriptional Machinery Transcribed Region Transcription factor binding sites § Promoter elements consist of short (~5-20 bp) DNA elements that serve as binding sites for transcription factor proteins § Transcription factor proteins can activate or repress the transcription of an adjacent gene
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
primary RNA transcript mRNA protein active/ inactive protein mRNA transcriptional control translation control post- translational control transport control mRNA stability control NUCLEUS CYTOSOL nuclear envelope 1 4 RNA processing control 2 3 6 5 Translational Control Genetic Code GGCAUGGACCAUAGAGGACAGUGACAAAAAA RNA 5’ 3’ § Translation: Protein M D H R G Q Stop Image from: http://www.mun.ca/biology/scarr/ Codon Usage § 4 3 = 64 codons > 20 amino acids § Many synonymous codons • Multiple codons coding for same amino acid • e.g. GGU, GGC, GGA, and GGG all code for Glycine (G) • Are all synonymous codons translated with equal efficiency? Codon Usage Bias § Some codons are translated more efficiently then others • Due to specific tRNA abundances § Organisms with genomes of high GC content use more GC-rich codons; those with low GC content use more AT-rich codons § Codon Adaptivity Index (CAI): w i = f i f max( i ) CAI g = w i i = 1 N " # $ % ( 1/ N § f i = frequency of codon i in the subset of highly expressed genes § f max(i) = frequency of codon most often used to code for the considered amino acid in the subset of highly expressed genes.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/20/2012 for the course MBIOS 478 taught by Professor Staff during the Fall '11 term at Washington State University .

Page1 / 7

Lecture2 - R e g u la tio n o f E u k a r y o tic G e n e E...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online