AUGCUGCCUUAUUACAGAGGGCAUUAA

AUGCUGCCUUAUUACAGAGGGCAUUAA - chain forms. As soon as the...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
AUGCUGCCUUAUUACAGAGGGCAUUAA    5. A second tRNA, with an anticodon complementary to the second codon (CUG) brings the  second amino acid to the ribosome and binds temporarily to the complementary codon on  mRNA.    6. The first two amino acids are joined by a peptide bond (enzymes associated with the  ribosome form this), and the first tRNA is released.     7. The third amino acid is brought by tRNA and a peptide bond is formed between amino acid  #2 and amino acid #3.    8. The second tRNA is released.     9. This continues, forming a polypeptide chain, until a STOP codon is reached.     10. The ribosome detaches from the mRNA and the polypeptide chain (which is usually a  complete protein) is released. The ribosome and the mRNA can be used again.   In the process of translation, the ribosome moves along the strand of mRNA as the polypeptide 
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: chain forms. As soon as the ribosome has moved along far enough to leave the START codon exposed, a second ribosome can bind and begin another polypeptide chain. These steps are quite similar in eukaryotic cells, but there are also some differences. Transcription occurs inside the nucleus. The completed mRNA then leaves the nucleus and goes to ribosomes for translation. But in eukaryotic cells an additional step is required, since the good information of the genes (exons) is all mixed up with the genetic "junk" (introns). After the mRNA is completed, with both introns and exons included, special enzymes snip out the introns and splice the exons together. Only then does the mRNA leave the nucleus....
View Full Document

This note was uploaded on 01/23/2012 for the course MCB MCB2010 taught by Professor Smith during the Fall '09 term at Broward College.

Ask a homework question - tutors are online