{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

AUGCUGCCUUAUUACAGAGGGCAUUAA

AUGCUGCCUUAUUACAGAGGGCAUUAA - chain forms As soon as the...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
AUGCUGCCUUAUUACAGAGGGCAUUAA    5. A second tRNA, with an anticodon complementary to the second codon (CUG) brings the  second amino acid to the ribosome and binds temporarily to the complementary codon on  mRNA.    6. The first two amino acids are joined by a peptide bond (enzymes associated with the  ribosome form this), and the first tRNA is released.     7. The third amino acid is brought by tRNA and a peptide bond is formed between amino acid  #2 and amino acid #3.    8. The second tRNA is released.     9. This continues, forming a polypeptide chain, until a STOP codon is reached.     10. The ribosome detaches from the mRNA and the polypeptide chain (which is usually a  complete protein) is released. The ribosome and the mRNA can be used again.   In the process of translation, the ribosome moves along the strand of mRNA as the polypeptide 
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: chain forms. As soon as the ribosome has moved along far enough to leave the START codon exposed, a second ribosome can bind and begin another polypeptide chain. These steps are quite similar in eukaryotic cells, but there are also some differences. Transcription occurs inside the nucleus. The completed mRNA then leaves the nucleus and goes to ribosomes for translation. But in eukaryotic cells an additional step is required, since the good information of the genes (exons) is all mixed up with the genetic "junk" (introns). After the mRNA is completed, with both introns and exons included, special enzymes snip out the introns and splice the exons together. Only then does the mRNA leave the nucleus....
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern