final exam review gentics

final exam review gentics - Final Exam Review 1. In humans,...

Info iconThis preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 10
Background image of page 11
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Final Exam Review 1. In humans, a dimple in the chin is ,a dominant trait. A manwithout a chin dimple but whose father had a chin dimple marries a woman with a chin dimple and a normal father. What proportion of their children will have a chin dimple? What proportion of the offspring of a heterozygous male and a homozygous recessive female will have the dominant phenotype? What are the most alleles that any one person can have at a single locus? From a cross of two individuals of genotype Ggfld, what proportion of the offspring would he expected to have the genotype Gng? What is the chance ofan aBit‘I gamete from an individual of genotype eases”de From the cross Aa BthDDEeFf it MBchDdEeFf, what is the chance of an offspring with the same genotype as the first parent? Two short hair cats mate and produce so: short-haired kittens and 2 Iong~haired kittens. How is the long—hair trait inherited and what are the genotypes of the short—ha ired parents? For two loci each with two alleles, one dominant and one recessive, what proportion of the cross between two double heterozygotes {at both loci} will have the recessive phenotype at either of the loci but not at both loci? In Jimsonweed, purple flower {3] is dominant to white flower {is}, and spiny-{G} is dominant to smooth [g]. In a cross between a plant homozygous for white flowers and spiny pods is crossed to a plant homozygous for purple and smooth pods. In a test cross of the F1 plants what proportion of the offspring would he expected to have purple flowers and spiny pods? 1i]. Alhanism, lack of pigmentation in humans, results from a recessive allele. Two normal parents have an albino child. What is the chance their next child will have normal pigmentation? 11. in a plant with EN = 22, how many chromatids are in the cell during GE? 12. Using a cell with EN = E, with one pair of metaoentric chromosomes and two telocentric pairs, draw a cell at the end ofthe first division of meiosis. 13. Using a cell of 2N=3, with four pairs of metacentric chromosomes, draw a cell that is in the beginning of meiosis I. 14. In Humans, red—green color blindness is due to a recessive allele at an lt—linlted locus. A couple has a color—blind daughter and a normal son. 1vilhat is the probability that the next two children will be color-blind? 15. When does DNA replication occur in a eukaryotic cell? 16. The arctic fox has 2N=5EJI chromosomes and the common red fth has 2N=38. These two species can interbreed and produce viable offspring. How many chromosomes would these hybrid offspring contain? 18. Using the pedigree at the end of this review, how is” bald trait inherited? 19. 1vil'hat is the chance the couple 3 it 2 will have a bald child? 21. How many Barr bodies would you predict to be present in a cell from_a XXHKKKKKY individual? 22. Ultra violet light can cause mutations in exposed slcin. A man of genotype BB, with parents both homozygous dominant, has a uv light induced mutation on his arm, changing the El allele to the b ailele. 1I.I'v'hat proportion of his children will receive a b allele from this man? 23. Brown teeth is inherited as a sex—linked dominant allele. Ifa woman with brown teeth who had a normal father marries a man with brown teeth what is the chance of this couple having a normalson? 24. Using the following cross in pea plants determine the genotype of the parents. ifellow {A} and tall {B} are dominant, green {a} and dwarf lb] are recessive. Give genotype in the order listed, first parent is the first genotype, etc. Parents: ‘r'ellow, Dwarf X Yellowflall Yellow,Tall Yellow, Dwarf Green, Tall lGreen, Dwarf 41 43 15 ‘ 14 25. Two loci, A and B are 18 map units apart on chromosome 12. From an indiyidual with the genotype AhfaB, what proportion of the gametes will haye the genotype AB? 26. If the penetrance of a certain dominant allele is it, what proportion of the offspring of two heterozygotes will have the dominant phenotype? 2?. in chickens. the frizzled feather phenotype is inherited as a dominant allele and is lethal when homozygous. From a cross of two frizzled chickenswhat proportion of the offspring will be normal? 23. Two parents both heterozygous at both the A30 and H loci haye B type hlood. What is the chance their first child will have E type blood? Use the following data, of a cross between a heterozygous female at all three loci and a homozygous recessiye father, answer the next two questions. lCurled {c}, purple'ip}, and black {lo} are three recessiye phenotypes at three separate loci. Wings eyes body number wild wild wild 4 curled purple black 5 curled wild wild 5? wild purple black 53 wild wild black 125 curled purple wild 123 curled I wild black 539 wild purple wild fl 1458 29. What is the linkage genotype of the female? [in correct order] 3D. What is the map distance between purple and black? Round map distance to 2 decimal places. 31. In monkeys, the genes D, E and F are linked with the Positions and distances shown below: D 1D E 3D F [with a coefficient of coincidence= 0.35] From a monkey with genotype DeFdef, what proportion of the gametes will have genotype def? ' 32. In a test of paternity two men are-accused, Man 1 has B type blood and Man 2 has A type blood. The mother has A type blood and the child has A type blood. Which man could not hate been the father ofthis child? 33. If parental gametes for three linked loci are Big and dFE. The double crossoyers were identified as DFG and dfg. Which locus is in the middle? 34. Two dominant mutations in pigs cause a pollen-c phenotype [Pu] or rough fur [R]. A double heterozygote for these two loci are crossed to a normal pig and the following offspring were counted: Roughfur 65 Nonnal 1GB Rough,poHex 95 _ PoHex T3 Are these loci linked and what is the genotype of the heterozygous parent? 35. How do we determine what is dominant and recessive? 36. With regards to genotypes, what is a true breeding organism? 31A certain double stranded piece of DNA has 31% A, what proportion of the bases in this DNA are E? 33. A stra nd of DNA has the sequence 5’-AGGCAGG£TA~3', what is the sequence of a complementary RNA strand? ' ' 39. Besides DNA Polymerase, there are a number of other enzymes that participate in DNA replication. Else 3 other enzymes and their function. 4D. What two things does DNA polymerase need in order to perform DNA replication? 41. What is the difference between a promoter and an ori sequence? 42. List two types of genomic DNA sequences that would not be present in cDNA made from the Iiyer? 41A woman has "Amnesia prior to Genetics Exam“ Syndrome [2N=45, ND} and is colorblind. If both her parents had normal color yision in which parent did nondisjunction occur? 44. The A and D locus are so tightly Iinlted that no recombination is ever observed between them. If Adfad is crossed to adfad, what proportion of the offspring have the aadd phenotype? 45. From an individual of genotype AbfaB Dd,-what proportion of the gametes will have abd? Assume the A and E loci are 24 units apart on chromosome 4 and the D locus is on chromosome 5. 45. in a certain plant there are two loci, one causing either red or white flowers and the other either tall or short plants. A test cross of a red, tall plant gave the following offspring: Red,TaH 43 Red, Short 4 White, Tail 6 White, Short 4? Are these loci linked? If so, what is the genotype of the red, tall parent? 4?. An individual is found tohave a EN = 4? chromsome number with genotype of KW for his sex chromosomes. In which parent and which division did non-disjunction occur? ' 43. Why are aneuploid genotypes of the sea chromosomes viable while most autosomal aneuploids are lethal? 43. For a species with a diploid number of 38, how many chromosomes would be in an individual that was trisomic for both chromosome number 4 and chromosome number 3? 50. When two plants belonging to the same genus but different species were crossed together, the F1 hybrid was larger and had more ornate flowers. Unfortunately, this hybid was sterile. What event could happen that could reverse the sterility and make the hybrid fertile? 51. Two normal parents have a son with 4? chromosomes {KEY} and he is colorblind. Assuming CE is a sex-linked recessive condition, which parent and which division of meiosis did nondisjunction occur? 52. .i-‘t certain locus in humans has 12 alleles labeled AIL-A12. From a cross AZIAB X Aflflll, what proportion of the offspring will have the A3 allele? 53. Fora species with diploid number 26, how many chromosomes will be present in the somatic nuclei {during Gil of triploid individuals? 54. Plant species F' has 2n = 18 and species U has 2n = 14. A fertile hybrid is found. How many chromosomes does the fertile hybrid have? r 55. In cooker spaniels, coat color is determined by two independently assorting loci. The presence of the dominant A and dominant Et alleles determines black coat color; bb with dominant A produces a liver coat; aa with dominant B produces a red coat; and aabb produces a lemon—colored coat. A black ooclter spaniel is mated to a lemon colored cockerispaniel and they have a lemon colored pup. If this same black cocker is mated to a homozygous red cocker spaniel, what proportion of the offspring will have a black coat? 56. Man #1 has been employed for several years in a nuclear power plant and has a son with hemophilia [an lit—linked recessive condition]. There is no history of hemophilia in either the man’s or his wife’s ancestors. Man #2 is employed in the same plant, also for a number of years, and has a child with achondroplastic dwarfism [an autosomal dominant condition}. Like the first man, there is no history of achondroplasia in his or his wife's families. Both men sue their employer for damages contending the mutation was caused by the father's work in the nuclear power plant and exposure to radiation {a known mutagen]. Which man has the stronger case? 5?. in a certain cross of three linked loci only 15 double crossovers were detected in lflU-U offspring. if the distance between the loci are, D———12———E———2Ci——H, what is the coefficient of coincidence for these three [oci? 58. Site two functions of a promoter. 59. A strange creature from Mars was found buried in Dr. Turner's lab. The genetic material from this organism was similar to DNA but had 3 bases instead of a. Proteins from this organism were similar but there were "32 different amino acids. What is the minimum number of bases necessary to code for each amino acid in the DNA of this organism? ’M. EU. in eukaryotes, what are two modifications that can occur to mRNA before it leaves the nucleus and moyes into the cytoplas in? 51. What is a position effect? 52. What process form tRNA and ritNA? 53. The normal sequence of markers on a Drosophila chromosome is 123ii45fii'89, where it represents the centromere. Some flies were isolated with the marker sequence 123#45d55?39. What type of mutation has occurred? 64. Two DNA double strands were isolated of the same length. if strand 1 has an AT content of 60% and strand 2 has an AT content of cost, which of these two strands has the higher melting temperature? 65. if a proka ryotic organism had a mutation that removed all 3’—5’ exonuciease activity from DNA polymerase, what would be the effect in the replicated DNA? 5?. Name two parts of the lac operon that has it’s effect in a cis position. 68. What amino acid is bonnd to the time with the antioodon B'GCUS'? ES. From the lac operon merozygote |5 F'+ 0' Z"?! l* P' 0" 2" it"; how would the Z and “(gene products be controlled: always on, always off, inducible? {Assume glucose levels are low} {There are tvro answers 2 and r for this problem} 2 if 'J'fl. From the lac operon merozygote l' P+ 0* Z" T! i5 P'“ D" 2* '1" , would the V gene product be: always on, always off, inducible....2 gene? ' Z —'___' ' I if" ?'1. A strand of DNA has the sequence 3'CGTCACGTACCGAGGTGCATCGAGCACTFMS'. If this is a template strand, after this sequence has been transcribed and translated how mam.»r amino acids would be in the resulting protein? Assume all that is necessaryr to begin translation is a start codon. T2. Name two differences between DNA and RNA. ":3. List two ways that eukawotic gene control mechanisms are different than proltaryrotic control mechanism s. F4. What is the order ofthe ribosomal binding sites that a charged tRNn adding leucine would bind as leucine is added to a growing protein? 1'5. In E. coli, four Hfr strains donate the following markers; shown in the order donated: Strain 1: MZXWC Strain 2: LANCW Strain 3: ALBRU Strain 4: ZMURB All ofthese Hfr strains are derived from the same Fri; strain. What is the order of these markers on the circular chromosome of the original F+? Start with the M marker. TE. What makes up a nucleosome? Ti“. List two ways that the structure of eukaryotic chromosomes differ from the structure of prolcaryotic chromosomes. i‘E. in the trp operon would a deletion ofthe attenuation leader sequence act cis or trans? F9. The order of three genes on a bacterial chromosome is C——D———E. From the cross Hfr C+D+E+ it F- C-D-E-J what should the rarest class of recombinant progeny? Si]. Using p22 as a transducing phage grown on an a+b+c+ bacterial donor, a recipient strain of genotype a—b—c— is infected and incubated. Later trasductants that are a+ are selected and checked for the ' presence of the other markers, giving the following results: bvc- SHE b+c- 113% b-c—i— 0% b+c+ 3% 82. What is an enhancer? 83. in conjugation experiments with F’ and F+ donors, recipient cells become H at a very high rate. Experiments with Hfr rarely have F+ recipients, how can you explain this result? 84. What type of mutation could cause partial trisomy or monosomy? 35. For the following data. what is the frequency of the L“ allele? ivl MN N :12 "£2 IUD 36. In a population, a rare recessive disease is found in EU of 2000 individuals. lrirssurning HW, what is the estimated frequency of homozygotes in this population? 8?. What happens at the beginning of meiosis? 33. If the frequency of the b allele that caUses PKU when homozygous is 3.2, what proportion of the population are heterozygotes? BS. Colorblindness results from a sex—linked recessive allele. Cine in every 30 males is colorblind. What is the proportion of colorblind women, assuming Hardy-Weinberg Equilibrium conditions? Ftandom side-track of notes that might help you study for tomorrow....then more question: Transition: purine to purine or pyrirnidine for pyrimidine Transyersion: Purine to pyrimidine or pyrimidine to purine Same Sense: Changes 3’” BF ofa codon, same amino acid and no change in the protein Mis—sense: single amino acid difference in the protein Non-sense: changes codon to stop codon, shortens the protein Fra meshift: add one base or two bases, everything from the insertion site is affected. Add 3 bases, ovarything the same, but now have an extra amino acid Thymine dimmer — must fix before replication. Must be in the right gene and the right mutation to cause skin cancer. then must also NOT be repaired before replication -. I I .. ._ 91. How is a somatic mutation different frpm a germ line mutation? 92. In a stra nd of DNi—‘i a Ti-‘i base pair is replaced by a' GC base pair. What type of DNA mutation is this? 93. Giye a likely explanation for the observation that for enzyme EL there is a normal amount ofmitl-lA for the protein. but only part of the protein sequence is present. 94. Two normal parents have a child with PKU and a normal child. What is the chance the normal child is a heterozygote. 95. How would a nonsense mutation affect the final protein after transcription and translation? 96. Point mutations that result in a single aminio acid change in a protein are called mutations. 9?. Starting with an AT base pair. what is an example ofa transition mutation? 98. The normai protein produced by a locus has the following sequence of amino acids: MET~H|S—TYR—VAL—TRP—GL‘E A mutant allele of the same locus has the amino acid sequence: MET-Hi5. If the mutant allele was the result of a single point mutation, this point mutation was most likely what type of m utation? 99. What two things are required for a LN induced thymine dimer to cause a skin tumor? 100. What is a restriction endonuciease? 101. What is an RFLP? What causes an RFLP? 102. Assuming that each DNA base is found in equal frequency, how often on the average would a restriction enzyme that identified the sequence WAGGT cut DNA? - 1m. in electrophoresis does DNA migrate towards the positiye or negative pole? 105. What does totipotent mean? Final Exam Review Key: 1} 1/3 2} V2 3} 2 4} 'z’; 5) NE 6} It'fid 7‘} recessive, Aa 2: An 3} 3f8 9} 121’: to) as ll} 44 12} 3 chromosomes, 6 chromatids 13} 8 chromosomes, 15 chromatids 14} 1a 15} S phase 15} 44 if} {no question} 18} autosomal recessive 19} us 213} (no question} 21) “F 22) zero at somatic mutation 23} 'xfi 24} Aahb a :1th 25} {3.139 25} 3t16 2?} 1:3 28} 9t 16 29} c+ict+p+ 30} 9.81 map units 31} [fi.l)(fl.3}{ié}(fl.35} = 13.313525 32} either one could he 33} I} 34} No, Rer 35} phenotype of the heterozygote as} homozygous at all loci 3?} 19% 38} 5’ [JAGCCLJGCCU 3’ 39} Primase, DNA Helicase, DNA ligase 413} Free 3’Dl-l, template strand 4i} ori sequence identifies where to start replication, promoter identifies where to start transcription 42} prornoters,it1trons 43) dad, 1st or 2mi 44) a 45) cos 4s) Yes, arms 4?) dad, 2mt ‘ 43} dosage compensation 49} 4t} 5U} chromosome doubling 51) mom, on“ 52} 1X2 53} 39 54} 32 55} V2 so) man #2 {if dominant, it would he more likely;r to have shown up in family history} 57} [1.66 58} identify template, hind RNA salt 59} 4 hases 613} S’Cap, Poly-a tail, intton removal 6 1} effect on expression of a gene when its location is changed (i.e., translocation} {i2} transcription 63) duplication as) strand #2 65} no proofi‘eading f more mutations as) (no question} 67} operator, promoter 68} Arg 69} 2; is OFF, Y is ON W} Z is ON, Y is OFF Tl} six 22} U vs. T,” single as double stranded, ribose vs. deoxyrihose T3} No operons, no attenuation r4) a-P-E TS} MZXWCNALBRU 16} DNA + histonc protein Ti} euk are linear and bound up with histone proteins 2'3} cis to} C+D—E+ 8U} order of markers % a-bnc til } {no question} 82} region of DNA that can hind proteins to enhance transcription levels , 83} for F+ the I3 plasmid goes through first, and for l—lfr the F plasmid goes through last 34} translocation 35) are 86} 13.52 87"} homologous Cs. Pair ss}o.32 as; {1.032 or acorn 913} (no question} 91} germ line can he passed onto offspring 92} transversion 93} non-sense mutation 94} 2t 3 95} shorter protein 96} mis—sense 9?} AC or GT 93}Non+sense (inserfiontdeletion) 99) Right gene, right mutation, not repaired lfifl} enzyme that cuts DNA at specific restriction sites hill} restriction fragment length polymorphism 102} ever},r 1324 hps 1133} (no question} Ill-4} positive 1135} a cell that has potential to become an adult ...
View Full Document

This note was uploaded on 02/03/2012 for the course BIO 3100 taught by Professor Turner during the Fall '08 term at The University of Akron.

Page1 / 11

final exam review gentics - Final Exam Review 1. In humans,...

This preview shows document pages 1 - 11. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online